Transcript: Human NM_001350603.1

Homo sapiens ubiquitin protein ligase E3D (UBE3D), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
UBE3D (90025)
Length:
1826
CDS:
594..1202

Additional Resources:

NCBI RefSeq record:
NM_001350603.1
NBCI Gene record:
UBE3D (90025)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130076 GCAAGTGTAGAAGTTACATCT pLKO.1 1437 3UTR 100% 4.950 3.960 N UBE3D n/a
2 TRCN0000416735 AGAGTTAACTTTAGATCTTTG pLKO_005 1375 3UTR 100% 10.800 7.560 N UBE3D n/a
3 TRCN0000147474 CTGCTGTAAATCCTAGGAAAT pLKO.1 1589 3UTR 100% 10.800 7.560 N UBE3D n/a
4 TRCN0000413334 TTGTAAGCGTTGCAAGGTAAT pLKO_005 656 CDS 100% 10.800 7.560 N UBE3D n/a
5 TRCN0000149633 GTAATGCCAATCTGCCTTCAT pLKO.1 1135 CDS 100% 4.950 3.465 N UBE3D n/a
6 TRCN0000146775 CTACAGTTTGTTGTTGGAGAT pLKO.1 334 5UTR 100% 4.050 2.835 N UBE3D n/a
7 TRCN0000149741 GCTACAGTTTGTTGTTGGAGA pLKO.1 333 5UTR 100% 2.640 1.848 N UBE3D n/a
8 TRCN0000417368 AGGAGGTATGCCCATGAATAT pLKO_005 213 5UTR 100% 13.200 7.920 N UBE3D n/a
9 TRCN0000146557 CAGACAGTTTGGTGATTGAAT pLKO.1 895 CDS 100% 5.625 3.375 N UBE3D n/a
10 TRCN0000148472 CAAAGACAAGAACCAGAGCTA pLKO.1 1293 3UTR 100% 2.640 1.584 N UBE3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04503 pDONR223 100% 51.9% 51.9% None 0_1ins561 n/a
2 ccsbBroad304_04503 pLX_304 0% 51.9% 51.9% V5 0_1ins561 n/a
3 TRCN0000476471 ATCCAATTGGGACATCCTATATAA pLX_317 32.9% 51.9% 51.9% V5 0_1ins561 n/a
Download CSV