Transcript: Human XM_017011459.2

PREDICTED: Homo sapiens ubiquitin protein ligase E3D (UBE3D), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE3D (90025)
Length:
4478
CDS:
95..1276

Additional Resources:

NCBI RefSeq record:
XM_017011459.2
NBCI Gene record:
UBE3D (90025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413334 TTGTAAGCGTTGCAAGGTAAT pLKO_005 718 CDS 100% 10.800 7.560 N UBE3D n/a
2 TRCN0000149633 GTAATGCCAATCTGCCTTCAT pLKO.1 1197 CDS 100% 4.950 3.465 N UBE3D n/a
3 TRCN0000146775 CTACAGTTTGTTGTTGGAGAT pLKO.1 305 CDS 100% 4.050 2.835 N UBE3D n/a
4 TRCN0000149741 GCTACAGTTTGTTGTTGGAGA pLKO.1 304 CDS 100% 2.640 1.848 N UBE3D n/a
5 TRCN0000417368 AGGAGGTATGCCCATGAATAT pLKO_005 184 CDS 100% 13.200 7.920 N UBE3D n/a
6 TRCN0000146557 CAGACAGTTTGGTGATTGAAT pLKO.1 957 CDS 100% 5.625 3.375 N UBE3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04503 pDONR223 100% 96.8% 97.7% None 1150_1151insTGGCCTTTTTGA;1154G>T;1156_1179del n/a
2 ccsbBroad304_04503 pLX_304 0% 96.8% 97.7% V5 1150_1151insTGGCCTTTTTGA;1154G>T;1156_1179del n/a
3 TRCN0000476471 ATCCAATTGGGACATCCTATATAA pLX_317 32.9% 96.8% 97.7% V5 1150_1151insTGGCCTTTTTGA;1154G>T;1156_1179del n/a
Download CSV