Construct: ORF TRCN0000476561
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015839.1_s317c1
- Derived from:
- ccsbBroadEn_07129
- DNA Barcode:
- AAAGATGGGATGGCTGCGAACTCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VIPR1 (7433)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476561
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_004624.4 | 99.8% | 99.7% | 444T>C;1022G>T |
| 2 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265437.2 | 99.6% | 99.5% | 397_398insAGC;441T>C;1019G>T |
| 3 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251885.1 | 93.9% | 93.2% | (many diffs) |
| 4 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251882.1 | 90.8% | 90.8% | 0_1ins123;321T>C;899G>T |
| 5 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265438.3 | 90.8% | 90.8% | 0_1ins123;321T>C;899G>T |
| 6 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_011534079.1 | 90.8% | 90.8% | 0_1ins123;321T>C;899G>T |
| 7 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_005265439.2 | 89.5% | 86.6% | (many diffs) |
| 8 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251884.1 | 89.3% | 86.4% | (many diffs) |
| 9 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XM_011534080.2 | 75.6% | 71.9% | (many diffs) |
| 10 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | NM_001251883.1 | 53.4% | 39.6% | (many diffs) |
| 11 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_001740254.1 | 48.6% | (many diffs) | |
| 12 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_940500.2 | 48.2% | (many diffs) | |
| 13 | human | 7433 | VIPR1 | vasoactive intestinal pepti... | XR_001740255.1 | 39.6% | (many diffs) | |
| 14 | mouse | 22354 | Vipr1 | vasoactive intestinal pepti... | XM_006512068.3 | 85.8% | 84.4% | (many diffs) |
| 15 | mouse | 22354 | Vipr1 | vasoactive intestinal pepti... | NM_011703.4 | 85.7% | 84.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1437
- ORF length:
- 1371
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg cccgccaagt ccgctgcccg cccgctggct atgcgtgctg gcaggcgccc 121 tcgcctgggc ccttgggccg gcgggcggcc aggcggccag gctgcaggag gagtgtgact 181 atgtgcagat gatcgaggtg cagcacaagc agtgcctgga ggaggcccag ctggagaatg 241 agacaatagg ctgcagcaag atgtgggaca acctcacctg ctggccagcc acccctcggg 301 gccaggtagt tgtcttggcc tgtcccctca tcttcaagct cttctcctcc attcaaggcc 361 gcaatgtaag ccgcagctgc accgacgaag gctggacgca cctggagcct ggcccgtacc 421 ccattgcctg tggtttggat gacaaggcag cgagtttgga tgagcagcag accatgttct 481 acggttctgt gaagaccggc tacaccatcg gctacggcct gtccctcgcc acccttctgg 541 tcgccacagc tatcctgagc ctgttcagga agctccactg cacgcggaac tacatccaca 601 tgcacctctt catatccttc atcctgaggg ctgccgctgt cttcatcaaa gacttggccc 661 tcttcgacag cggggagtcg gaccagtgct ccgagggctc ggtgggctgt aaggcagcca 721 tggtcttttt ccaatattgt gtcatggcta acttcttctg gctgctggtg gagggcctct 781 acctgtacac cctgcttgcc gtctccttct tctctgagcg gaagtacttc tgggggtaca 841 tactcatcgg ctggggggta cccagcacat tcaccatggt gtggaccatc gccaggatcc 901 attttgagga ttatgggtgc tgggacacca tcaactcctc actgtggtgg atcataaagg 961 gccccatcct cacctccatc ttggtaaact tcatcctgtt tatttgcatc atccgaatcc 1021 tgcttcagaa actgcggccc ccagatatca ggaagagtga cagcagtcca tactcaaggc 1081 tagccatgtc cacactcctg ctgatccccc tgtttggagt acactacatc atgttcgcct 1141 tctttccgga caattttaag cctgaagtga agatggtctt tgagctcgtc gtggggtctt 1201 tccagggttt tgtggtggct aTCCTCTACT GCTTCCTCAA TGGTGAGGTG CAGGCGGAGC 1261 TGAGGCGGAA GTGGCGGCGC TGGCACCTGC AGGGCGTCCT GGGCTGGAAC CCCAAATACC 1321 GGCACCCGTC GGGAGGCAGC AACGGCGCCA CGTGCAGCAC GCAGGTTTCC ATGCTGACCC 1381 GCGTCAGCCC AGGTGCCCGC CGCTCCTCCA GCTTCCAAGC CGAAGTCTCC CTGGTCTGCC 1441 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1501 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1561 ATATATCTTG TGGAAAGGAC GAAAAGATGG GATGGCTGCG AACTCCACGC GTTAAGTCga 1621 caatcaacct ctggattaca aaatttgtga aagatt