Transcript: Human NM_001251884.1

Homo sapiens vasoactive intestinal peptide receptor 1 (VIPR1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
VIPR1 (7433)
Length:
2699
CDS:
160..1389

Additional Resources:

NCBI RefSeq record:
NM_001251884.1
NBCI Gene record:
VIPR1 (7433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001251884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358222 TCGCCTTCTTTCCGGACAATT pLKO_005 1085 CDS 100% 13.200 18.480 N VIPR1 n/a
2 TRCN0000014213 GCTGTCAAGTTCCTTTGGGTT pLKO.1 1852 3UTR 100% 2.640 2.112 N VIPR1 n/a
3 TRCN0000014217 CGCCTTCTTTCCGGACAATTT pLKO.1 1086 CDS 100% 13.200 9.240 N VIPR1 n/a
4 TRCN0000014216 CCTCACCTCCATCTTGGTAAA pLKO.1 918 CDS 100% 10.800 7.560 N VIPR1 n/a
5 TRCN0000358223 GACCATCGCCAGGATCCATTT pLKO_005 834 CDS 100% 10.800 7.560 N VIPR1 n/a
6 TRCN0000014214 CCTGAAGTGAAGATGGTCTTT pLKO.1 1111 CDS 100% 4.950 3.465 N VIPR1 n/a
7 TRCN0000014215 GCACCTCTTCATATCCTTCAT pLKO.1 552 CDS 100% 4.950 3.465 N VIPR1 n/a
8 TRCN0000358230 CCTCACTGTGGTGGATCATAA pLKO_005 887 CDS 100% 13.200 7.920 N VIPR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001251884.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07129 pDONR223 100% 89.3% 86.4% None (many diffs) n/a
2 ccsbBroad304_07129 pLX_304 0% 89.3% 86.4% V5 (many diffs) n/a
3 TRCN0000476561 AAAGATGGGATGGCTGCGAACTCC pLX_317 16.2% 89.3% 86.4% V5 (many diffs) n/a
4 TRCN0000491293 CAAGCCACGGCCGGCCACCGCAAA pLX_317 20.4% 89.2% 86.2% V5 (many diffs) n/a
5 TRCN0000489217 CCCCCCTGAAGTTTGTATTGCCAC pLX_317 25.1% 89.2% 86.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV