Construct: ORF TRCN0000476765
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011970.1_s317c1
- Derived from:
- ccsbBroadEn_03200
- DNA Barcode:
- CCCATGTGATCTCGCGATTGTGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YBX2 (51087)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476765
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51087 | YBX2 | Y-box binding protein 2 | NM_015982.4 | 100% | 100% | |
| 2 | human | 51087 | YBX2 | Y-box binding protein 2 | XM_017024713.2 | 96% | 96% | 368_412del |
| 3 | mouse | 53422 | Ybx2 | Y box protein 2 | XM_006533738.3 | 88.9% | 89% | (many diffs) |
| 4 | mouse | 53422 | Ybx2 | Y box protein 2 | NM_016875.2 | 88.5% | 89.8% | (many diffs) |
| 5 | mouse | 53422 | Ybx2 | Y box protein 2 | XM_006533739.3 | 81% | 80.8% | (many diffs) |
| 6 | mouse | 53422 | Ybx2 | Y box protein 2 | XM_006533740.1 | 68.6% | 68.1% | (many diffs) |
| 7 | mouse | 53422 | Ybx2 | Y box protein 2 | NM_001347634.1 | 68.2% | 68.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1158
- ORF length:
- 1092
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag cgaggtggag gcggcagcgg gggctacagc ggtccccgcg gcgacggtgc 121 ccgcgacggc ggcaggggtg gtagcggtgg tggtaccggt gcccgcaggg gagccgcaga 181 aaggcggcgg ggcgggcggc gggggcggag ccgcctcggg ccccgctgct gggaccccct 241 cggcgccggg ctcccgcacc cctggcaatc cggcgacggc ggtctcggga acccccgccc 301 ccccggcccg gagtcaggcg gacaagccgg tgctggcaat ccaagtcctg ggcactgtca 361 aatggttcaa cgtccggaat ggttacggat tcatcaacag gaatgacacc aaggaagatg 421 tctttgttca ccagacagct attaaaagaa acaaccccag gaagtttctg cgcagcgttg 481 gagatgggga gactgtggaa tttgatgtcg tggaaggaga gaagggcgca gaagccacta 541 atgtaactgg gcctggggga gtacccgtga agggcagccg ttatgccccc aaccgacgta 601 agtcccgccg attcatcccc cggcctccct cagttgcccc accacccatg gtggcagaga 661 tcccctcggc ggggacagga cctggcagta aaggggagcg ggctgaagac tctgggcaac 721 ggccccgacg atggtgcccc ccacccttct tctaccgacg gcggtttgtg cgaggccccc 781 ggcctcccaa ccAGCAGCAG CCTATAGAGG GCACTGACAG GGTAGAACCC AAAGAGACAG 841 CCCCATTGGA GGGGCACCAA CAGCAGGGAG ATGAGCGAGT CCCCCCGCCC AGATTCCGGC 901 CCAGGTACCG AAGGCCTTTC CGCCCCAGGC CACGCCAGCA GCCTACCACA GAAGGTGGGG 961 ATGGTGAGAC CAAGCCCAGC CAAGGTCCCG CTGATGGTTC CCGGCCTGAG CCCCAGCGCC 1021 CACGAAACCG CCCCTACTTC CAGCGGAGAC GGCAGCAGGC CCCTGGCCCC CAGCAGGCCC 1081 CTGGCCCCCG GCAGCCCGCA GCCCCTGAGA CCTCAGCCCC TGTCAACAGT GGGGACCCCA 1141 CCACCACCAT CCTGGAGTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1201 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1261 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACCCATGT GATCTCGCGA 1321 TTGTGTCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt