Construct: ORF TRCN0000476872
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012292.1_s317c1
- Derived from:
- ccsbBroadEn_03277
- DNA Barcode:
- TCGATTCATGTCTGCGGACCAGTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNK9 (51305)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476872
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51305 | KCNK9 | potassium two pore domain c... | NM_001282534.2 | 100% | 100% | |
| 2 | human | 51305 | KCNK9 | potassium two pore domain c... | XM_011517102.2 | 100% | 100% | |
| 3 | human | 51305 | KCNK9 | potassium two pore domain c... | XM_011517101.2 | 77.1% | 75.1% | (many diffs) |
| 4 | human | 51305 | KCNK9 | potassium two pore domain c... | XM_017013530.1 | 70.5% | 70.5% | 0_1ins330 |
| 5 | human | 51305 | KCNK9 | potassium two pore domain c... | XM_017013531.1 | 70.5% | 70.5% | 0_1ins330 |
| 6 | human | 51305 | KCNK9 | potassium two pore domain c... | XM_011517103.2 | 51.6% | 48.4% | (many diffs) |
| 7 | human | 51305 | KCNK9 | potassium two pore domain c... | NR_104210.2 | 33.4% | 1_131del;1254_3358del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1191
- ORF length:
- 1122
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagaggcag aacgtgcgga ctctgtccct catcgtctgc accttcacct 121 acctgctggt gggcgccgcc gtgttcgacg ccctcgagtc ggaccacgag atgcgcgagg 181 aggagaaact caaagccgag gagatccgga tcaaggggaa gtacaacatc agcagcgagg 241 actaccggca gctggagctg gtgatcctgc agtcggaacc gcaccgcgcc ggcgtccagt 301 ggaaattcgc cggctccttc tactttgcga tcacggtcat caccaccata ggttatgggc 361 acgctgcacc tggcaccgat gcgggcaagg ccttctgcat gttctacgcc gtgctgggca 421 tcccgctgac actggtcatg ttccagagcc tgggcgagcg catgaacacc ttcgtgcgct 481 acctgctgaa gcgcattaag aagtgctgtg gcatgcgcaa cactgacgtg tctatggaga 541 acatggtgac tgtgggcttc ttctcctgca tggggacgct gtgcatcggg gcggccgcct 601 tctcccagtg tgaggagtgg agcttcttcc acgcctacta ctactgcttc atcacgttga 661 ctaccattgg gttcggggac tacgtggccc tgcagaccaa gggtgccctg cagaagaagc 721 cgctctacgt ggcctttagc tttatgtata tcctggtggg gctgacggtc atcggggcct 781 tcctcaacct ggtcgtccTC AGGTTCTTGA CCATGAACAG TGAGGATGAG CGGCGGGATG 841 CTGAAGAGAG GGCATCCCTC GCCGGAAACC GCAACAGCAT GGTCATTCAC ATCCCTGAGG 901 AGCCGCGGCC CAGCCGGCCC AGGTACAAGG CGGACGTCCC GGACCTGCAG TCTGTGTGCT 961 CCTGCACCTG CTACCGCTCG CAGGACTATG GCGGCCGCTC GGTGGCACCG CAGAACTCCT 1021 TCAGCGCCAA GCTTGCCCCC CACTACTTCC ACTCCATCTC TTACAAGATC GAGGAGATCT 1081 CACCAAGCAC ATTAAAAAAC AGCCTCTTCC CATCGCCTAT TAGCTCCATC TCTCCTGGGT 1141 TACACAGCTT TACCGACCAC CAGAGGCTGA TGAAACGCCG GAAGTCCGTT TTGCCAACTT 1201 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1261 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1321 CTTGTGGAAA GGACGATCGA TTCATGTCTG CGGACCAGTG ACGCGTTAAG TCgacaatca 1381 acctctggat tacaaaattt gtgaaagatt