Transcript: Human XM_017013530.1

PREDICTED: Homo sapiens potassium two pore domain channel subfamily K member 9 (KCNK9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNK9 (51305)
Length:
4958
CDS:
190..984

Additional Resources:

NCBI RefSeq record:
XM_017013530.1
NBCI Gene record:
KCNK9 (51305)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428810 CCTCTTCCCATCGCCTATTAG pLKO_005 894 CDS 100% 13.200 18.480 N KCNK9 n/a
2 TRCN0000435576 TCATCACGTTGACTACCATTG pLKO_005 440 CDS 100% 6.000 8.400 N KCNK9 n/a
3 TRCN0000044557 GATCTCACCAAGCACATTAAA pLKO.1 867 CDS 100% 15.000 10.500 N KCNK9 n/a
4 TRCN0000432150 ACCACCAGAGGCTGATGAAAC pLKO_005 947 CDS 100% 10.800 7.560 N KCNK9 n/a
5 TRCN0000044555 CCTGCTGAAGCGCATTAAGAA pLKO.1 273 CDS 100% 5.625 3.938 N KCNK9 n/a
6 TRCN0000044554 CGTGGCCTTTAGCTTTATGTA pLKO.1 519 CDS 100% 5.625 3.938 N KCNK9 n/a
7 TRCN0000044553 CCACTCCATCTCTTACAAGAT pLKO.1 840 CDS 100% 4.950 3.465 N KCNK9 n/a
8 TRCN0000069603 CGCCTACTACTACTGCTTCAT pLKO.1 423 CDS 100% 4.950 2.475 Y Kcnk15 n/a
9 TRCN0000043729 CCACGCCTACTACTACTGCTT pLKO.1 420 CDS 100% 2.640 1.320 Y KCNK15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03277 pDONR223 100% 70.5% 70.5% None 0_1ins330 n/a
2 ccsbBroad304_03277 pLX_304 0% 70.5% 70.5% V5 0_1ins330 n/a
3 TRCN0000476872 TCGATTCATGTCTGCGGACCAGTG pLX_317 35.1% 70.5% 70.5% V5 0_1ins330 n/a
Download CSV