Construct: ORF TRCN0000476939
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003406.1_s317c1
- Derived from:
- ccsbBroadEn_07609
- DNA Barcode:
- CTGGCAAGTGCACACTTCGAACAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRRN2 (10446)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476939
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10446 | LRRN2 | leucine rich repeat neuronal 2 | NM_006338.3 | 99.8% | 99.7% | 1064T>C;1476A>G;2026G>C |
| 2 | human | 10446 | LRRN2 | leucine rich repeat neuronal 2 | NM_201630.2 | 99.8% | 99.7% | 1064T>C;1476A>G;2026G>C |
| 3 | human | 10446 | LRRN2 | leucine rich repeat neuronal 2 | XM_005244827.3 | 99.8% | 99.7% | 1064T>C;1476A>G;2026G>C |
| 4 | human | 10446 | LRRN2 | leucine rich repeat neuronal 2 | XM_011509066.2 | 99.8% | 99.7% | 1064T>C;1476A>G;2026G>C |
| 5 | human | 10446 | LRRN2 | leucine rich repeat neuronal 2 | XM_017000050.2 | 99.8% | 99.7% | 1064T>C;1476A>G;2026G>C |
| 6 | mouse | 16980 | Lrrn2 | leucine rich repeat protein... | NM_010732.4 | 85.3% | 87.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2205
- ORF length:
- 2139
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gcttctcgtg gccccactct tgctagcttg ggtggctggt gccactgccg 121 ctgtgcccgt ggtaccctgg catgttccct gcccccctca gtgtgcctgc cagatccggc 181 cctggtatac gccccgctcg tcctaccgcg aggctaccac tgtggactgc aatgacctat 241 tcctgacggc agtccccccg gcactccccg caggcacaca gaccctgctc ctgcagagca 301 acagcattgt ccgtgtggac cagagtgagc tgggctacct ggccaatctc acagagctgg 361 acctgtccca gaacagcttt tcggatgccc gagactgtga tttccatgcc ctgccccagc 421 tgctgagcct gcacctagag gagaaccagc tgacccggct ggaggaccac agctttgcag 481 ggctggccag cctacaggaa ctctatctca accacaacca gctctaccgc atcgccccca 541 gggccttttc tggcctcagc aacttgctgc ggctgcacct caactccaac ctcctgaggg 601 ccattgacag ccgctggttt gaaatgctgc ccaacttgga gatactcatg attggcggca 661 acaaggtaga tgccatcctg gacatgaact tccggcccct ggccaacctg cgtagcctgg 721 tgctagcagg catgaacctg cgggagatct ccgactatgc cctggagggg ctgcaaagcc 781 tggagagcct ctccttctat gacaaccagc tggcccgggt gcccaggcgg gcactggaac 841 aggtgcccgg gctcaagttc ctagacctca acaagaaccc gctccagcgg gtagggccgg 901 gggactttgc caacatgctg caccttaagg agctgggact gaacaacatg gaggagctgg 961 tctccatcga caagtttgcc ctggtgaacc tccccgagct gaccaagctg gacatcacca 1021 ataacccacg gctgtccttc atccaccccc gcgccttcca ccacctgccc cagatggaga 1081 ccctcatgct caacaacaac gctctcagtg ccttgcacca gcagacggcg gagtccctgc 1141 ccaacctgca ggaggtaggt ctccacggca accccatccg ctgtgactgt gtcatccgct 1201 gggccaatgc cacgggcacc cgtgtccgct tcatcgagcc gcaatccacc ctgtgtgcgg 1261 agcctccgga cctccagcgc ctcccggtcc gtgaggtgcc cttccgggag atgacggacc 1321 actgtttgcc cctcatctcc ccacgaagct tccccccaag cctccaggta gccagtggag 1381 agagcatggt gctgcattgc cgggcactgg ccgaacccga acccgagatc tactgggtca 1441 ctccagctgg gcttcgactg acacctgccc atgcaggcag gaggtaccgg gtgtaccccg 1501 aggggaccct ggagctgcgg agggtgacag cagaagaggc ggggctatac acctgtgtgg 1561 cccagaacct ggtgggggct gacactaaga cggttagtgt ggttgtgggc cgtgctctcc 1621 tccagccagg cagggacgaa ggacaggggc tggagctccg ggtgcaggag acccacccct 1681 atcacatcct gctatcttgg gtcaccccac ccaacacagt gtccaccaac ctcacctggt 1741 ccagtgcctc ctccctccgg ggccaggggg ccacagctct ggcccgcctg cctcggggaa 1801 cccacagcta caacattacc cgcctccttc aggccacgga gtactgggCC TGCCTGCAAG 1861 TGGCCTTTGC TGATGCCCAC ACCCAGTTGG CTTGTGTATG GGCCAGGACC AAAGAGGCCA 1921 CTTCTTGCCA CAGAGCCTTA GGGGACCGTC CTGGGCTCAT TGCCATCCTG GCTCTCGCTG 1981 TCCTTCTCCT GGCAGCTGGG CTAGCGGCCC ACCTTGGCAC AGGCCAACCC AGGAAGGGTG 2041 TGGGTGGGAG GCGGCCTCTC CCTCCAGCCT GGGCTTTCTG GGGCTGGAGT CCCCCTTCTG 2101 TCCGGGTTGT GTCTGCTCCC CTCGTCCTGC CCTGGAATCC AGGGAGGAAG CTGCCCAGAT 2161 CCTCAGAAGG GGAGACACTG TTGCCACCAT TGTCTCAAAA TTCTTGCCCA ACTTTCTTGT 2221 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2281 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 2341 GAAAGGACGA CTGGCAAGTG CACACTTCGA ACAAACGCGT TAAGTCgaca atcaacctct 2401 ggattacaaa atttgtgaaa gatt