Transcript: Mouse NM_010732.4

Mus musculus leucine rich repeat protein 2, neuronal (Lrrn2), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Lrrn2 (16980)
Length:
3346
CDS:
540..2732

Additional Resources:

NCBI RefSeq record:
NM_010732.4
NBCI Gene record:
Lrrn2 (16980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108535 CGTTGATTGATCCACGTGCTT pLKO.1 2773 3UTR 100% 2.640 3.696 N Lrrn2 n/a
2 TRCN0000005780 CTGGTCTCCATCGACAAGTTT pLKO.1 1431 CDS 100% 5.625 3.938 N LRRN2 n/a
3 TRCN0000108537 CCATATCACATCCTGCTGTTT pLKO.1 2151 CDS 100% 4.950 3.465 N Lrrn2 n/a
4 TRCN0000108538 GCCCAACTTGGAAATCCTCAT pLKO.1 1103 CDS 100% 4.050 2.835 N Lrrn2 n/a
5 TRCN0000108539 CCACGGCTTTCTTTCATCCAT pLKO.1 1500 CDS 100% 3.000 2.100 N Lrrn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010732.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07609 pDONR223 100% 85.3% 87.8% None (many diffs) n/a
2 ccsbBroad304_07609 pLX_304 0% 85.3% 87.8% V5 (many diffs) n/a
3 TRCN0000476939 CTGGCAAGTGCACACTTCGAACAA pLX_317 16.9% 85.3% 87.8% V5 (many diffs) n/a
Download CSV