Construct: ORF TRCN0000476944
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015071.1_s317c1
- Derived from:
- ccsbBroadEn_13456
- DNA Barcode:
- TGCACAGACATCTATAGGGCCACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BPIFC (254240)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476944
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 254240 | BPIFC | BPI fold containing family C | XM_017028740.1 | 58.6% | 58.6% | 1_558del |
| 2 | human | 254240 | BPIFC | BPI fold containing family C | XM_011530091.2 | 58% | 58% | 1_402del;823_993del |
| 3 | human | 254240 | BPIFC | BPI fold containing family C | NM_174932.2 | 52% | 52% | 1_558del;979_1149del |
| 4 | human | 254240 | BPIFC | BPI fold containing family C | XM_011530088.2 | 52% | 52% | 1_558del;979_1149del |
| 5 | human | 254240 | BPIFC | BPI fold containing family C | XM_011530089.2 | 52% | 52% | 1_558del;979_1149del |
| 6 | human | 254240 | BPIFC | BPI fold containing family C | XM_011530090.2 | 52% | 52% | 1_558del;979_1149del |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 861
- ORF length:
- 792
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagaaaccc attttaaaga acttaaatga aatgctctgt cccattattg 121 caagtgaagt caaagcgcta aatgccaacc tcagcacact ggaggtttta accaagattg 181 acaactacac tctgctggat tactccctaa tcagttctcc agaaattact gagaactacc 241 ttgacctgaa cttgaagggt gtattctacc cactggaaaa cctcaccgac ccccccttct 301 caccagttcc ttttgtgctc ccagaacgca gcaactccat gctctacatt ggaatcgccg 361 agtatttctt taaatctgcg tcctttgctc atttcacagc tggggttttc aatgtcactc 421 tctccaccga agagatttcc aaccattttg ttcaaaactc tcaaggcctt GGCAACGTGC 481 TCTCCCGGGT TGCTAGTACC AGTGTTGGCC TGGTTATTTT GGGACAAAGA CTGGTCTGCT 541 CCTTGTCTCT GAACAGATTC CGCCTTGCTT TGCCAGAGTC CAATCGCAGC AACATTGAGG 601 TCTTGAGGTT TGAAAATATT CTATCGTCCA TTCTTCACTT TGGAGTCCTC CCACTGGCCA 661 ATGCAAAATT GCAGCAAGGA TTTCCTCTGT CCAATCCACA CAAATTCTTA TTCGTCAATT 721 CAGATATTGA AGTTCTTGAG GGTTTCCTTT TGATTTCCAC CGACCTGAAG TATGAAACAT 781 CCTCAAAGCA GCAGCCAAGT TTCCACGTAT GGGAAGGTCT GAACCTGATA AGCAGACAGT 841 GGAGGGGGAA GTCAGCCCCT TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATGCA CAGACATCTA 1021 TAGGGCCACC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt