Transcript: Human XM_011530091.2

PREDICTED: Homo sapiens BPI fold containing family C (BPIFC), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BPIFC (254240)
Length:
2006
CDS:
181..1548

Additional Resources:

NCBI RefSeq record:
XM_011530091.2
NBCI Gene record:
BPIFC (254240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011530091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416630 GAAATGCTCTGTCCCATTATT pLKO_005 613 CDS 100% 15.000 12.000 N BPIFC n/a
2 TRCN0000151882 CTATCGTCCATTCTTCACTTT pLKO.1 1306 CDS 100% 4.950 3.960 N BPIFC n/a
3 TRCN0000417524 ATCTGCGTCCTTTGCTCATTT pLKO_005 888 CDS 100% 13.200 9.240 N BPIFC n/a
4 TRCN0000152041 CCTAATCAGTTCTCCAGAAAT pLKO.1 720 CDS 100% 13.200 9.240 N BPIFC n/a
5 TRCN0000415578 TATTCGTCAATTCAGATATTG pLKO_005 1394 CDS 100% 13.200 9.240 N BPIFC n/a
6 TRCN0000155680 CCATGGACTTCGTTGCTAGTA pLKO.1 1163 CDS 100% 4.950 3.465 N BPIFC n/a
7 TRCN0000155934 CCTGGAATCAAGGCAAGGATT pLKO.1 262 CDS 100% 4.950 2.970 N BPIFC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011530091.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13456 pDONR223 100% 58% 58% None 1_402del;823_993del n/a
2 ccsbBroad304_13456 pLX_304 0% 58% 58% V5 1_402del;823_993del n/a
3 TRCN0000476944 TGCACAGACATCTATAGGGCCACC pLX_317 49.2% 58% 58% V5 1_402del;823_993del n/a
Download CSV