Transcript: Human XM_017028740.1

PREDICTED: Homo sapiens BPI fold containing family C (BPIFC), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BPIFC (254240)
Length:
1991
CDS:
181..1533

Additional Resources:

NCBI RefSeq record:
XM_017028740.1
NBCI Gene record:
BPIFC (254240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155681 CGGAGTCTACTTTACCGGTAT pLKO.1 588 CDS 100% 4.050 5.670 N BPIFC n/a
2 TRCN0000416630 GAAATGCTCTGTCCCATTATT pLKO_005 769 CDS 100% 15.000 12.000 N BPIFC n/a
3 TRCN0000151882 CTATCGTCCATTCTTCACTTT pLKO.1 1291 CDS 100% 4.950 3.960 N BPIFC n/a
4 TRCN0000417524 ATCTGCGTCCTTTGCTCATTT pLKO_005 1044 CDS 100% 13.200 9.240 N BPIFC n/a
5 TRCN0000152041 CCTAATCAGTTCTCCAGAAAT pLKO.1 876 CDS 100% 13.200 9.240 N BPIFC n/a
6 TRCN0000415578 TATTCGTCAATTCAGATATTG pLKO_005 1379 CDS 100% 13.200 9.240 N BPIFC n/a
7 TRCN0000156064 CGGAGAACTCAGTGTTCTGTA pLKO.1 699 CDS 100% 0.495 0.347 N BPIFC n/a
8 TRCN0000155934 CCTGGAATCAAGGCAAGGATT pLKO.1 262 CDS 100% 4.950 2.970 N BPIFC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13456 pDONR223 100% 58.6% 58.6% None 1_558del n/a
2 ccsbBroad304_13456 pLX_304 0% 58.6% 58.6% V5 1_558del n/a
3 TRCN0000476944 TGCACAGACATCTATAGGGCCACC pLX_317 49.2% 58.6% 58.6% V5 1_558del n/a
Download CSV