Construct: ORF TRCN0000476948
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002633.1_s317c1
- Derived from:
- ccsbBroadEn_11457
- DNA Barcode:
- GTCGACATGGCGCACCAGGGCGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- AKAP9 (10142)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476948
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011654.2 | 8% | 7.9% | (many diffs) |
| 2 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_024446631.1 | 8% | 7.9% | (many diffs) |
| 3 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011653.2 | 7.9% | 7.9% | (many diffs) |
| 4 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | NM_147185.3 | 7.9% | 7.9% | (many diffs) |
| 5 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011652.2 | 7.9% | 7.9% | (many diffs) |
| 6 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | NM_005751.4 | 7.9% | 7.9% | (many diffs) |
| 7 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011651.2 | 7.9% | 7.9% | (many diffs) |
| 8 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011650.2 | 7.9% | 7.9% | (many diffs) |
| 9 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011649.2 | 7.9% | 7.8% | (many diffs) |
| 10 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011648.2 | 7.9% | 7.8% | (many diffs) |
| 11 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011647.2 | 7.9% | 7.8% | (many diffs) |
| 12 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011646.2 | 7.9% | 7.8% | (many diffs) |
| 13 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011644.2 | 7.8% | 7.8% | (many diffs) |
| 14 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011643.2 | 7.8% | 7.8% | (many diffs) |
| 15 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011642.2 | 7.8% | 7.8% | (many diffs) |
| 16 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011645.2 | 7.3% | 7.3% | (many diffs) |
| 17 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011655.2 | 4.7% | 4.6% | (many diffs) |
| 18 | human | 10142 | AKAP9 | A-kinase anchoring protein 9 | XM_017011656.2 | 4.7% | 4.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1008
- ORF length:
- 942
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggacgaggag agacagaaga agctggaggc cggcaaagcc aagcttgccc 121 agtttcgaca aagaaaagct cagtcggatg ggcagagtcc ttccaagaag cagaaaaaaa 181 agagaaaaac gtcaagcagt aaacatgatg tgtcagcaca ccatgatttg aatattgatc 241 aatcacagtg taatgaaatg tacataaata gttctcagag agtagaatca actgtgattc 301 ctgaatctac aataatgaga actctacata gtggagaaat aaccagtcat gagcagggct 361 tctctgtgga actggaaagt gaaatttcaa ccacagcaga tgactgcagt tcagaggtaa 421 atggttgcag ttttgtgatg agaacaggaa agcctacaaa tttattaagg gaagaagaat 481 ttggtgttga tgattcttat tctgaacaag gagcacaaga cagtccgact catctagaga 541 tgatggaaag tgagttggct gggaagcagc atgagattga agagctaaac agagagctgg 601 aagaaatgag ggttaccTAT GGGACTGAAG GACTGCAGCA GTTACAAGAA TTTGAAGCTG 661 CCATTAAACA AAGAGATGGC ATTATAACCC AGCTCACTGC TAATTTACAA CAAGCAAGAA 721 GAGAAAAGGA TGAGACAATG AGAGAATTTT TAGAGTTGAC AGAACAGAGT CAAAAATTAC 781 AGATTCAATT TCAGCAATTA CAGGCTAGTG AAACTCTGAG AAACAGCACT CATAGTAGCA 841 CAGCTGCAGA CTTACTACAA GCCAAACAAC AGATCCTCAC TCATCAACAG CAGCTTGAAG 901 AACAAGACCA CTTATTAGAA GATTATCAGA AAAAGAAAGA AGACTTCACA ATGCAAATTA 961 GTTTCTTGCA AGAGAAAATT AAAGTATATG AAATGGTATG TTTATTTTAC CCAACTTTCT 1021 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1081 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1141 GTGGAAAGGA CGAGTCGACA TGGCGCACCA GGGCGACACG CGTTAAGTCg acaatcaacc 1201 tctggattac aaaatttgtg aaagatt