Transcript: Human XM_017011642.2

PREDICTED: Homo sapiens A-kinase anchoring protein 9 (AKAP9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AKAP9 (10142)
Length:
16329
CDS:
234..12140

Additional Resources:

NCBI RefSeq record:
XM_017011642.2
NBCI Gene record:
AKAP9 (10142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232466 AGAATCAAACTACGCTAAATT pLKO_005 10841 CDS 100% 15.000 10.500 N AKAP9 n/a
2 TRCN0000232464 AGTCATCTGCCAGCCTAATTT pLKO_005 5620 CDS 100% 15.000 10.500 N AKAP9 n/a
3 TRCN0000232465 CGCAGTGAAGAACGGGATAAA pLKO_005 10065 CDS 100% 13.200 9.240 N AKAP9 n/a
4 TRCN0000037937 GCCAAGAAGAAAGATTGATTT pLKO.1 2626 CDS 100% 13.200 9.240 N AKAP9 n/a
5 TRCN0000232463 TGTGGATCAGGTTCGTGAATA pLKO_005 3614 CDS 100% 13.200 9.240 N AKAP9 n/a
6 TRCN0000232467 TATGAACACAGCTTATGATTG pLKO_005 13682 3UTR 100% 10.800 7.560 N AKAP9 n/a
7 TRCN0000037935 GCTCTCATTTACCAGAAGAAA pLKO.1 11508 CDS 100% 5.625 3.938 N AKAP9 n/a
8 TRCN0000037938 GCACAAATGAATGGTAGGAAA pLKO.1 9663 CDS 100% 4.950 3.465 N AKAP9 n/a
9 TRCN0000037936 GCAGTCTTAAAGAAGAGCTTA pLKO.1 3664 CDS 100% 4.950 3.465 N AKAP9 n/a
10 TRCN0000037934 GCTGACTATTTCAGAAGAAAT pLKO.1 4868 CDS 100% 1.320 0.924 N AKAP9 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 13097 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11457 pDONR223 100% 7.8% 7.8% None (many diffs) n/a
2 ccsbBroad304_11457 pLX_304 0% 7.8% 7.8% V5 (many diffs) n/a
3 TRCN0000476948 GTCGACATGGCGCACCAGGGCGAC pLX_317 41.6% 7.8% 7.8% V5 (many diffs) n/a
Download CSV