Construct: ORF TRCN0000476990
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014026.1_s317c1
- Derived from:
- ccsbBroadEn_05352
- DNA Barcode:
- CGGTTAGCGTGAGTGACCGTCTCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD21 (283219)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476990
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 283219 | KCTD21 | potassium channel tetrameri... | NM_001029859.3 | 100% | 100% | |
| 2 | human | 283219 | KCTD21 | potassium channel tetrameri... | XM_005273928.1 | 100% | 100% | |
| 3 | human | 283219 | KCTD21 | potassium channel tetrameri... | XM_006718517.2 | 100% | 100% | |
| 4 | human | 283219 | KCTD21 | potassium channel tetrameri... | XM_006718518.3 | 100% | 100% | |
| 5 | human | 283219 | KCTD21 | potassium channel tetrameri... | XM_011544955.3 | 100% | 100% | |
| 6 | human | 283219 | KCTD21 | potassium channel tetrameri... | XM_006718516.3 | 87.8% | 87.8% | 1_108del |
| 7 | human | 283219 | KCTD21 | potassium channel tetrameri... | XM_005273925.3 | 79% | 79% | 1_207del |
| 8 | mouse | 622320 | Kctd21 | potassium channel tetrameri... | NM_001039039.3 | 91.4% | 99.6% | (many diffs) |
| 9 | mouse | 622320 | Kctd21 | potassium channel tetrameri... | XM_006508100.2 | 91.4% | 99.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 849
- ORF length:
- 780
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtccgacccc atcacgctga acgtcggggg gaagctctat acaacctcac 121 tggcgaccct gaccagcttc cctgactcca tgctaggcgc catgttcagc gggaagatgc 181 ccaccaagag ggacagccag ggcaactgct tcattgaccg tgacggcaaa gtgttccgct 241 atatcctcaa cttcctgcgg acctcccacc ttgacctgcc tgaggacttc caggagatgg 301 ggctgctccg cagggaggcc gacttctacc aggtgcagcc cctgattgag gccctgcagg 361 agaaggaagt ggagctctcc aaggccgaga agaatgccat gctcaacatc acactgaacc 421 agcgtgtgca gacggtccac ttcactgtgc gcgaggcacc ccagatctac agcctctccT 481 CTTCCAGCAT GGAGGTCTTC AACGCCAACA TCTTCAGCAC CTCCTGCCTC TTCCTCAAGC 541 TCCTTGGCTC TAAGCTCTTC TACTGCTCCA ATGGCAATCT CTCCTCCATC ACCAGCCACT 601 TGCAGGACCC CAACCACCTG ACTCTGGACT GGGTGGCCAA TGTGGAGGGC CTGCCAGAGG 661 AGGAGTACAC CAAGCAGAAC CTCAAGAGGC TCTGGGTGGT GCCCGCCAAC AAGCAGATCA 721 ACAGCTTCCA GGTCTTCGTG GAAGAGGTAC TGAAAATCGC TCTGAGCGAT GGCTTCTGCA 781 TCGATTCTTC TCACCCACAT GCTCTGGATT TTATGAACAA TAAGATTATT CGATTAATAC 841 GGTACAGGTT GCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 901 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 961 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACGGTTA GCGTGAGTGA CCGTCTCTAC 1021 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt