Transcript: Human XM_006718516.3

PREDICTED: Homo sapiens potassium channel tetramerization domain containing 21 (KCTD21), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCTD21 (283219)
Length:
6568
CDS:
3149..4039

Additional Resources:

NCBI RefSeq record:
XM_006718516.3
NBCI Gene record:
KCTD21 (283219)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006718516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139215 CTTCTACTGCTCCAATGGCAA pLKO.1 3745 CDS 100% 2.640 3.696 N KCTD21 n/a
2 TRCN0000139617 CAACTGCTTCATTGACCGTGA pLKO.1 3391 CDS 100% 2.160 3.024 N KCTD21 n/a
3 TRCN0000139257 CATCGATTCTTCTCACCCACA pLKO.1 3967 CDS 100% 2.160 3.024 N KCTD21 n/a
4 TRCN0000139364 CCCATGATGAAGTCCACCTTT pLKO.1 4175 3UTR 100% 4.950 3.465 N KCTD21 n/a
5 TRCN0000139768 CCTTGGCTCTAAGCTCTTCTA pLKO.1 3730 CDS 100% 4.950 3.465 N KCTD21 n/a
6 TRCN0000121755 CGGTTTATTATGACAAGTGAA pLKO.1 4258 3UTR 100% 4.950 3.465 N KCTD21 n/a
7 TRCN0000145150 GCCAGTGTAATGAAATCACTT pLKO.1 4759 3UTR 100% 4.950 3.465 N KCTD21 n/a
8 TRCN0000139178 CGAGAAGAATGCCATGCTCAA pLKO.1 3574 CDS 100% 4.050 2.835 N KCTD21 n/a
9 TRCN0000140024 GATCAACAGCTTCCAGGTCTT pLKO.1 3904 CDS 100% 4.050 2.835 N KCTD21 n/a
10 TRCN0000139705 CAATGGCAATCTCTCCTCCAT pLKO.1 3757 CDS 100% 2.640 1.848 N KCTD21 n/a
11 TRCN0000139704 CCATGCTCAACATCACACTGA pLKO.1 3585 CDS 100% 2.640 1.848 N KCTD21 n/a
12 TRCN0000143306 GAAGCTCTATACAACCTCACT pLKO.1 3289 CDS 100% 2.640 1.848 N KCTD21 n/a
13 TRCN0000140568 GATTCTTCTCACCCACATGCT pLKO.1 3971 CDS 100% 2.640 1.848 N KCTD21 n/a
14 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1871 5UTR 100% 4.950 2.475 Y ERAP2 n/a
15 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 5964 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 5964 3UTR 100% 4.050 2.025 Y ORAI2 n/a
17 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 5964 3UTR 100% 4.050 2.025 Y P3H4 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1872 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006718516.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05352 pDONR223 100% 87.8% 87.8% None 1_108del n/a
2 ccsbBroad304_05352 pLX_304 0% 87.8% 87.8% V5 1_108del n/a
3 TRCN0000476990 CGGTTAGCGTGAGTGACCGTCTCT pLX_317 47.3% 87.8% 87.8% V5 1_108del n/a
Download CSV