Construct: ORF TRCN0000477006
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013617.1_s317c1
- Derived from:
- ccsbBroadEn_12645
- DNA Barcode:
- TCGAACTTGAGCCTACGAGATATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KIAA0319L (79932)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477006
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79932 | KIAA0319L | KIAA0319 like | XM_006710910.1 | 100% | 100% | |
| 2 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002374.1 | 99.2% | 99.1% | 840_854del |
| 3 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002377.1 | 85.6% | 80% | 1704_1705ins91;1776_1777ins206 |
| 4 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002378.1 | 69.8% | 69.6% | 0_1ins615;225_239del |
| 5 | human | 79932 | KIAA0319L | KIAA0319 like | NM_024874.5 | 65.8% | 65.8% | 1_1074del |
| 6 | human | 79932 | KIAA0319L | KIAA0319 like | XM_006710907.1 | 65.8% | 65.8% | 1_1074del |
| 7 | human | 79932 | KIAA0319L | KIAA0319 like | XM_006710909.2 | 65.8% | 65.8% | 1_1074del |
| 8 | human | 79932 | KIAA0319L | KIAA0319 like | XM_011542179.2 | 65.8% | 65.8% | 1_1074del |
| 9 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002366.1 | 65.5% | 65.4% | 1_1074del;1914_1928del |
| 10 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002367.1 | 65.5% | 65.4% | 1_1074del;1914_1928del |
| 11 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002368.1 | 65.5% | 65.4% | 1_1074del;1914_1928del |
| 12 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002369.2 | 65.5% | 65.4% | 1_1074del;1914_1928del |
| 13 | human | 79932 | KIAA0319L | KIAA0319 like | XM_011542180.1 | 56.4% | 53.2% | 1_1074del;2778_2779ins91;2850_2851ins206 |
| 14 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002372.2 | 56.4% | 53.2% | 1_1074del;2778_2779ins91;2850_2851ins206 |
| 15 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002370.1 | 56.1% | 52.9% | (many diffs) |
| 16 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002371.1 | 56.1% | 52.9% | (many diffs) |
| 17 | human | 79932 | KIAA0319L | KIAA0319 like | XR_001737421.1 | 46.9% | (many diffs) | |
| 18 | human | 79932 | KIAA0319L | KIAA0319 like | XM_017002373.2 | 46.1% | 45.8% | (many diffs) |
| 19 | human | 79932 | KIAA0319L | KIAA0319 like | XR_001737425.1 | 42.4% | (many diffs) | |
| 20 | human | 79932 | KIAA0319L | KIAA0319 like | XR_001737426.1 | 41.4% | 1_1131del;2409_2410ins160;3045_4451del | |
| 21 | human | 79932 | KIAA0319L | KIAA0319 like | XR_946763.2 | 40.8% | 1_1301del;3187_3479del;3668_5074del | |
| 22 | human | 79932 | KIAA0319L | KIAA0319 like | XR_001737420.1 | 40.7% | (many diffs) | |
| 23 | human | 79932 | KIAA0319L | KIAA0319 like | XR_001737423.1 | 40.3% | 1_1301del;2740_2741ins143;3232_4638del | |
| 24 | human | 79932 | KIAA0319L | KIAA0319 like | XR_002957627.1 | 40.2% | (many diffs) | |
| 25 | human | 79932 | KIAA0319L | KIAA0319 like | XR_246296.1 | 40% | 1_1301del;2579_2580ins160;3215_4621del | |
| 26 | human | 79932 | KIAA0319L | KIAA0319 like | XR_001737424.1 | 39.8% | (many diffs) | |
| 27 | mouse | 100317 | AU040320 | expressed sequence AU040320 | XM_017319898.1 | 59.7% | 62.9% | (many diffs) |
| 28 | mouse | 100317 | AU040320 | expressed sequence AU040320 | XM_017319899.1 | 59.7% | 62.9% | (many diffs) |
| 29 | mouse | 100317 | AU040320 | expressed sequence AU040320 | NM_133886.2 | 58.5% | 61.7% | (many diffs) |
| 30 | mouse | 100317 | AU040320 | expressed sequence AU040320 | XM_017319894.1 | 58.5% | 61.7% | (many diffs) |
| 31 | mouse | 100317 | AU040320 | expressed sequence AU040320 | XM_017319895.1 | 58.5% | 61.7% | (many diffs) |
| 32 | mouse | 100317 | AU040320 | expressed sequence AU040320 | XM_017319896.1 | 58.5% | 61.7% | (many diffs) |
| 33 | mouse | 100317 | AU040320 | expressed sequence AU040320 | XM_017319897.1 | 58.5% | 61.7% | (many diffs) |
| 34 | mouse | 100317 | AU040320 | expressed sequence AU040320 | NM_001035525.1 | 56% | 57.1% | (many diffs) |
| 35 | mouse | 100317 | AU040320 | expressed sequence AU040320 | NM_001035526.1 | 56% | 57.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2139
- ORF length:
- 2073
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agggaaacat tcccagatcc tcaaactatc gaagctcact ccaggcctgt 121 atgaattcaa agtgattgta gagggtcaaa atgcccatgg ggaaggctat gtgaacgtga 181 cagtcaagcc agagccccgt aagaatcggc cccccattgc tattgtgtca cctcagttcc 241 aggagatctc tttgccaacc acttctacag tcattgatgg cagtcaaagc actgatgatg 301 ataaaatcgt tcagtaccat tgggaagaac ttaaggggcc tctaagagaa gagaagattt 361 ctgaagatac agccatatta aaactaagta aactcgtccc tgggaactac actttcagct 421 tgactgtagt agactctgat ggagctacca actctactac tgcaaacctg acagtgaaca 481 aagctgtgga ttacccccct gtggccaacg caggccccaa ccaagtgatc accctgcccc 541 aaaactccat caccctcttt gggaaccaga gcactgatga tcatggcatc accagctatg 601 agtggtcact cagcccaagc agcaaaggga aagtggtgga gatgcagggt gttagaacac 661 caaccttaca gctctctgcg atgcaagaag gagactacac ttaccagctc acagtgactg 721 acacaatagg acagcaggcc actgctcaag tgactgttat tgtgcaacct gaaaacaata 781 agcctcctca ggcagatgca ggcccagata aagagctgac ccttcctgtg gatagcacaa 841 ccctggatgg cagcaagagc tcagatgatc agaaaattat ctcatatctc tgggaaaaaa 901 cacagggacc tgatggggtg cagctcgaga atgctaacag cagtgttgct actgtgactg 961 ggctgcaagt ggggacctat gtgttcacct tgactgtcaa agatgagagg aacctgcaaa 1021 gccagagctc tgtgaatgtc attgtcaaag aagaaataaa caaaccacct atagccaaga 1081 taactgggaa tgtggtgatt accctaccca cgagcacagc agagctggat ggctctaagt 1141 cctcagatga caagggaata gtcagctacc tctggactcg agatgagggg agcccagcag 1201 caggggaggt gttaaatcac tctgaccatc accctatcct ttttctttca aacctggttg 1261 agggaaccta cacttttcac ctgaaagtga ccgatgcaaa gggtgagagt gacacagacc 1321 ggaccactgt ggaggtgaaa cctgatccca ggaaaaacaa cctggtggag atcatcttgg 1381 atatcaacgt cagtcagcta actgagaggc tgaaggggat gttcatccgc cagattgggg 1441 tcctcctggg ggtgctggat tccgacatca ttgtgcaaaa gattcagccg tacacggagc 1501 agagcaccaa aatggtattt tttgttcaaa acgagcctcc ccaccagatc ttcaaaggcc 1561 atgaggtggc agcgatgctc aagagtgagc tgcggaagca aaaggcagac tttttgatat 1621 tcagagcctt ggaagtcaac actgtcacat gtcagctgaa ctgttccgac catggccact 1681 gtgactcgtt caccaaacgc tgtatctgtg accctttttG GATGGAGAAT TTCATCAAGG 1741 TGCAGCTGAG GGATGGAGAC AGCAACTGTG AGTGGAGCGT GTTATATGTT ATCATTGCTA 1801 CCTTTGTCAT TGTTGTTGCC TTGGGAATCC TGTCTTGGAC TGTGATCTGT TGTTGTAAGA 1861 GGCAAAAAGG AAAACCCAAG AGGAAAAGCA AGTACAAGAT CCTGGATGCC ACGGATCAGG 1921 AAAGCCTGGA GCTGAAGCCA ACCTCCCGAG CAGGCATCAA ACAGAAAGGC CTTTTGCTAA 1981 GTAGCAGCCT GATGCACTCC GAGTCAGAGC TGGACAGCGA TGATGCCATC TTTACATGGC 2041 CAGACCGAGA GAAGGGCAAA CTCCTGCATG GTCAGAATGG CTCTGTACCC AACGGGCAGA 2101 CCCCTCTGAA GGCCAGGAGC CCGCGGGAGG AGATCCTGTA CCCAACTTTC TTGTACAAAG 2161 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 2221 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 2281 ACGATCGAAC TTGAGCCTAC GAGATATCAC GCGTTAAGTC gacaatcaac ctctggatta 2341 caaaatttgt gaaagatt