Transcript: Mouse NM_001035525.1

Mus musculus expressed sequence AU040320 (AU040320), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
AU040320 (100317)
Length:
3697
CDS:
137..3394

Additional Resources:

NCBI RefSeq record:
NM_001035525.1
NBCI Gene record:
AU040320 (100317)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001035525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340737 ATCTGGTACTCCGCAAGTAAA pLKO_005 916 CDS 100% 13.200 18.480 N AU040320 n/a
2 TRCN0000340788 GCGTGCTCTACGTCATCATTG pLKO_005 2919 CDS 100% 10.800 15.120 N AU040320 n/a
3 TRCN0000120615 CGCAATGCAAGAAGGAGACTA pLKO.1 1819 CDS 100% 4.950 6.930 N AU040320 n/a
4 TRCN0000340786 CGCAATGCAAGAAGGAGACTA pLKO_005 1819 CDS 100% 4.950 6.930 N AU040320 n/a
5 TRCN0000120616 CCCAAGAATGTGTCCATCCAT pLKO.1 866 CDS 100% 3.000 4.200 N AU040320 n/a
6 TRCN0000340736 CCCAAGAATGTGTCCATCCAT pLKO_005 866 CDS 100% 3.000 4.200 N AU040320 n/a
7 TRCN0000120614 CGGGACTTATGTATTCACCTT pLKO.1 2113 CDS 100% 2.640 3.696 N AU040320 n/a
8 TRCN0000120613 GCCAACCACTTCTACCATCAT pLKO.1 1396 CDS 100% 4.950 3.465 N AU040320 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001035525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12645 pDONR223 100% 56% 57.1% None (many diffs) n/a
2 ccsbBroad304_12645 pLX_304 0% 56% 57.1% V5 (many diffs) n/a
3 TRCN0000477006 TCGAACTTGAGCCTACGAGATATC pLX_317 20.5% 56% 57.1% V5 (many diffs) n/a
Download CSV