Transcript: Human XR_946763.2

PREDICTED: Homo sapiens KIAA0319 like (KIAA0319L), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0319L (79932)
Length:
5074
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946763.2
NBCI Gene record:
KIAA0319L (79932)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123111 GCTACCTTTGTCATTGTTGTT pLKO.1 3033 3UTR 100% 4.950 6.930 N KIAA0319L n/a
2 TRCN0000134069 GCTACCTTTGTCATTGTTGTT pLKO.1 3033 3UTR 100% 4.950 6.930 N KIAA0319L n/a
3 TRCN0000134420 GACTGTGATCTGTTGTTGTAA pLKO.1 3074 3UTR 100% 5.625 4.500 N KIAA0319L n/a
4 TRCN0000134785 CTGAGATGGTAGCATAGAAAT pLKO.1 4154 3UTR 100% 13.200 9.240 N KIAA0319L n/a
5 TRCN0000303427 GTGAATGACTCCAACGAATTA pLKO_005 843 3UTR 100% 13.200 9.240 N KIAA0319L n/a
6 TRCN0000123109 GCTGAGATGGTAGCATAGAAA pLKO.1 4153 3UTR 100% 5.625 3.938 N KIAA0319L n/a
7 TRCN0000135444 GCTGAGATGGTAGCATAGAAA pLKO.1 4153 3UTR 100% 5.625 3.938 N KIAA0319L n/a
8 TRCN0000299018 GCTGAGATGGTAGCATAGAAA pLKO_005 4153 3UTR 100% 5.625 3.938 N KIAA0319L n/a
9 TRCN0000123113 CCAACCACTTCTACAGTCATT pLKO.1 1491 3UTR 100% 4.950 3.465 N KIAA0319L n/a
10 TRCN0000299019 CCAACCACTTCTACAGTCATT pLKO_005 1491 3UTR 100% 4.950 3.465 N KIAA0319L n/a
11 TRCN0000123110 CCACTGCTCAAGTGACTGTTA pLKO.1 1975 3UTR 100% 4.950 3.465 N KIAA0319L n/a
12 TRCN0000138093 GCATCAACTCATTGGGCTCTT pLKO.1 4838 3UTR 100% 4.050 2.835 N KIAA0319L n/a
13 TRCN0000303425 GCATCAACTCATTGGGCTCTT pLKO_005 4838 3UTR 100% 4.050 2.835 N KIAA0319L n/a
14 TRCN0000123112 CCAAAGAATGTATCAGTGCAA pLKO.1 960 3UTR 100% 2.640 1.848 N KIAA0319L n/a
15 TRCN0000135078 CCTGAAATATCAGAGGGTCTT pLKO.1 981 3UTR 100% 4.050 2.430 N KIAA0319L n/a
16 TRCN0000303426 CCTGAAATATCAGAGGGTCTT pLKO_005 981 3UTR 100% 4.050 2.430 N KIAA0319L n/a
17 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4197 3UTR 100% 4.950 2.475 Y ERAP2 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4198 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946763.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12645 pDONR223 100% 40.8% None 1_1301del;3187_3479del;3668_5074del n/a
2 ccsbBroad304_12645 pLX_304 0% 40.8% V5 1_1301del;3187_3479del;3668_5074del n/a
3 TRCN0000477006 TCGAACTTGAGCCTACGAGATATC pLX_317 20.5% 40.8% V5 1_1301del;3187_3479del;3668_5074del n/a
Download CSV