Construct: ORF TRCN0000477015
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013190.1_s317c1
- Derived from:
- ccsbBroadEn_02269
- DNA Barcode:
- CTCCTATCAGTATCCGGCTTACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP44 (9912)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477015
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | NM_014859.6 | 100% | 100% | |
| 2 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | NM_001321166.2 | 99.2% | 99.2% | 1522_1523insGCCTTAGGAAAATCCAAA |
| 3 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | NM_001321167.2 | 94.5% | 94.3% | 2317_2318insATCTTGTCCA;2320G>T;2322_2323ins122 |
| 4 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | NM_001321164.2 | 93.8% | 93.6% | (many diffs) |
| 5 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | XM_005256891.2 | 90.2% | 90.2% | 1522_1523ins240 |
| 6 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | NM_001321168.2 | 69.3% | 69.1% | (many diffs) |
| 7 | human | 9912 | ARHGAP44 | Rho GTPase activating prote... | NR_135569.2 | 47.7% | 1_341del;1863_1864ins416;2380_3854del | |
| 8 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | XM_006532871.3 | 87.5% | 93.6% | (many diffs) |
| 9 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | NM_001099288.1 | 86.7% | 92.9% | (many diffs) |
| 10 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | XM_006532872.3 | 82.8% | 88.4% | (many diffs) |
| 11 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | NM_175003.3 | 82.1% | 87.6% | (many diffs) |
| 12 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | XM_006532873.3 | 79.6% | 85.2% | (many diffs) |
| 13 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | XM_006532874.3 | 77.3% | 82.4% | (many diffs) |
| 14 | mouse | 216831 | Arhgap44 | Rho GTPase activating prote... | XM_017314452.1 | 74.9% | 79.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2523
- ORF length:
- 2454
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagaagcag ttcaatcgca tgcgccagct ggccaaccag acggtgggca 121 gggctgaaaa gacagaagtt ttgagtgaag accttcttca ggtggagaag cgtctggagc 181 tggtgaaaca ggtgtcccac agcacgcaca agaagctcac cgcatgtctg cagggccagc 241 aaggggcaga ggctgacaag cgctccaaaa agttgccttt gacaacactg gctcagtgtc 301 tgatggaggg gtcagctatc ctgggagatg acacacttct tgggaagatg ctgaaactct 361 gtggagagac ggaggacaag ctggctcagg agctgataca ttttgagttg caagtagaga 421 gagacgtgat tgagcccctg tttttgctgg cggaggtgga aatcccaaat attcaaaagc 481 agaggaaaca cttagccaag ttggtgctgg acatggattc ctcacgaacc aggtggcagc 541 agacttccaa gtcttcaggt ttgtccagca gcttacagcc tgcgggtgcc aaggctgatg 601 ccctcaggga agaaatggaa gaggctgcca acagagtgga gatttgcagg gaccagctct 661 cagctgatat gtacagtttt gtggccaaag aaattgacta tgcaaactac tttcaaacgc 721 taatagaagt gcaagctgaa taccacagga agtccctgac actattgcag gctgtattgc 781 ctcagatcaa agcacaacag gaggcctggg tagagaagcc ttccttcggg aagccgctgg 841 aggagcacct caccatcagc ggccgggaga tcgccttccc catcgaggcg tgtgtgacca 901 tgctgcttga gtgtgggatg caggaggagg gactcttccg agtagccccc tctgcctcca 961 aactgaagaa gctgaaagcg gccctggact gctgcgtggt ggatgtgcag gagtactcgg 1021 cagaccccca cgcaattgca ggagctttga aatcttacct ccgagagttg ccagaacctc 1081 ttatgacctt tgaactctat gatgagtgga tccaggcttc caatgtccag gagcaagaca 1141 agaagcttca ggctctatgg aatgcttgtg aaaagttgcc caaggccaat cacaacaaca 1201 tccgatactt gataaaattt ttatccaagc tgtcagaata tcaagatgta aacaagatga 1261 ctcccagtaa tatggcaatt gttttaggac ccaacctcct atggccacaa gcagaaggga 1321 acattacaga gatgatgacc acagtgtcgc tgcaaattgt tgggatcatt gaacctatca 1381 tccagcatgc agactggttc ttccctgggg agatagagtt caacattact ggcaattatg 1441 ggagtccagt acacgtgaac cataatgcca actacagctc aatgccctcc ccagacatgg 1501 accctgctga ccggcgccag cccgagcagg cccgccggcc cctcagcgtc gccacggata 1561 atatgatgct ggagttttac aaaaaggatg gccttaggaa aatccaaagc atgggtgtga 1621 gggtcatgga cacaaactgg gtggctcgaa gaggctcctc ggccggtcgg aaagtgtcct 1681 gcgccccgcc ctccatgcag cctcccgccc cgcccgccga gctggctgcg cccctgcctt 1741 cgccgctgcc ggagcagccc ctggacagcc ccgcggcccc cgcgctctct ccatccggcc 1801 tgggcctcca gcctgggccc gagcgcacca gcacaacaaa aagcaaggaa ctttctccag 1861 gctctgcaca gaaaggaagt ccaggctcca gccagggcac agcctgtgca gggactcaac 1921 caggggctca acctggagct cagccgggcg ccagccccag ccccagccag ccgcctgcag 1981 accagagtcc tcacaccctc cggaaagttt caaagaagct ggcaccgatt ccacccaagg 2041 tcccctttgg CCAGCCGGGG GCTATGGCAG ACCAGTCCGC TGGCCAGCCG TCCCCAGTCA 2101 GCCTGTCCCC CACCCCGCCC AGCACCCCGT CACCCTATGG ACTGAGCTAC CCTCAGGGGT 2161 ACTCCTTGGC CTCGGGCCAG CTCTCCCCAG CTGCAGCTCC TCCCCTGGCC TCTCCTTCTG 2221 TCTTTACAAG CACTTTGAGC AAATCGCGGC CCACTCCTAA GCCGCGACAG AGACCTACTC 2281 TGCCGCCTCC TCAGCCTCCC ACAGTAAACC TCTCGGCCTC TAGTCCACAG TCCACGGAGG 2341 CCCCCATGCT AGATGGCATG TCCCCTGGGG AAAGCATGTC TACAGATCTT GTCCACTTTG 2401 ATATTCCCTC GATCCACATA GAGCTCGGGT CGACGCTCCG CCTGAGTCCC CTGGAGCACA 2461 TGCGGCGACA CTCAGTAACT GACAAGAGGG ACTCGGAGGA GGAGTCTGAG AGCACCGCCC 2521 TCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 2581 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 2641 GGCTTTATAT ATCTTGTGGA AAGGACGACT CCTATCAGTA TCCGGCTTAC CGACGCGTTA 2701 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt