Transcript: Mouse NM_175003.3

Mus musculus Rho GTPase activating protein 44 (Arhgap44), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arhgap44 (216831)
Length:
4099
CDS:
324..2618

Additional Resources:

NCBI RefSeq record:
NM_175003.3
NBCI Gene record:
Arhgap44 (216831)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200812 GCAATAATTCTGTTTCCCAAA pLKO.1 3538 3UTR 100% 4.050 5.670 N Arhgap44 n/a
2 TRCN0000201786 GCCTGTTCATACTTTGGGATT pLKO.1 3678 3UTR 100% 4.050 5.670 N Arhgap44 n/a
3 TRCN0000279690 ACTACTTTCAAACGCTAATAG pLKO_005 961 CDS 100% 13.200 10.560 N ARHGAP44 n/a
4 TRCN0000192326 CCAAACACATTAGGGATCTTA pLKO.1 3438 3UTR 100% 5.625 3.938 N Arhgap44 n/a
5 TRCN0000201847 GAGCCTCTTATGACCTTTGAA pLKO.1 1329 CDS 100% 5.625 3.938 N Arhgap44 n/a
6 TRCN0000190477 GCTTCTAATATCCAGGAGCAA pLKO.1 1371 CDS 100% 2.640 1.848 N Arhgap44 n/a
7 TRCN0000279692 TGGCCAAAGAAATTGACTATG pLKO_005 937 CDS 100% 10.800 6.480 N ARHGAP44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02269 pDONR223 100% 82.1% 87.6% None (many diffs) n/a
2 ccsbBroad304_02269 pLX_304 0% 82.1% 87.6% V5 (many diffs) n/a
3 TRCN0000477015 CTCCTATCAGTATCCGGCTTACCG pLX_317 19.4% 82.1% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_15684 pDONR223 0% 12.3% 12.8% None (many diffs) n/a
5 ccsbBroad304_15684 pLX_304 0% 12.3% 12.8% V5 (many diffs) n/a
6 TRCN0000471721 TGCCTTCTTGTCGTTCTTTACTTT pLX_317 100% 12.2% 12.6% V5 (many diffs) n/a
Download CSV