Transcript: Human NR_135569.2

Homo sapiens Rho GTPase activating protein 44 (ARHGAP44), transcript variant 6, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ARHGAP44 (9912)
Length:
3854
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135569.2
NBCI Gene record:
ARHGAP44 (9912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135569.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279691 TCAGCGTCGCCACGGATAATA pLKO_005 1816 3UTR 100% 15.000 21.000 N ARHGAP44 n/a
2 TRCN0000279690 ACTACTTTCAAACGCTAATAG pLKO_005 979 3UTR 100% 13.200 18.480 N ARHGAP44 n/a
3 TRCN0000183518 GCATGCAAAGTCAAAGTTTAA pLKO.1 3471 3UTR 100% 13.200 18.480 N ARHGAP44 n/a
4 TRCN0000148288 CCCAGTAATATGGCAATTGTT pLKO.1 1536 3UTR 100% 5.625 7.875 N ARHGAP44 n/a
5 TRCN0000146493 CGTGAACCATAATGCCAACTA pLKO.1 1727 3UTR 100% 4.950 6.930 N ARHGAP44 n/a
6 TRCN0000279712 CGTGAACCATAATGCCAACTA pLKO_005 1727 3UTR 100% 4.950 6.930 N ARHGAP44 n/a
7 TRCN0000279692 TGGCCAAAGAAATTGACTATG pLKO_005 955 3UTR 100% 10.800 7.560 N ARHGAP44 n/a
8 TRCN0000149749 GCTGCAAATTGTTGGGATCAT pLKO.1 1622 3UTR 100% 4.950 3.465 N ARHGAP44 n/a
9 TRCN0000183517 GCTGTCAGAATATCAAGATGT pLKO.1 1502 3UTR 100% 4.950 3.465 N ARHGAP44 n/a
10 TRCN0000146476 CCACTTTGATATTCCCTCGAT pLKO.1 2250 3UTR 100% 2.640 1.848 N ARHGAP44 n/a
11 TRCN0000180480 GCAAGCTGAATACCACAGGAA pLKO.1 1004 3UTR 100% 2.640 1.848 N ARHGAP44 n/a
12 TRCN0000297714 AGGTCTTGCAGGATCAGTTTA pLKO_005 2792 3UTR 100% 13.200 7.920 N ARHGAP44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135569.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02269 pDONR223 100% 47.7% None 1_341del;1863_1864ins416;2380_3854del n/a
2 ccsbBroad304_02269 pLX_304 0% 47.7% V5 1_341del;1863_1864ins416;2380_3854del n/a
3 TRCN0000477015 CTCCTATCAGTATCCGGCTTACCG pLX_317 19.4% 47.7% V5 1_341del;1863_1864ins416;2380_3854del n/a
4 ccsbBroadEn_15684 pDONR223 0% 8.4% None (many diffs) n/a
5 ccsbBroad304_15684 pLX_304 0% 8.4% V5 (many diffs) n/a
6 TRCN0000471721 TGCCTTCTTGTCGTTCTTTACTTT pLX_317 100% 8.4% V5 1_1920del;2243_2245delATC;2250_3854delinsG n/a
Download CSV