Construct: ORF TRCN0000477022
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016897.1_s317c1
- Derived from:
- ccsbBroadEn_09515
- DNA Barcode:
- TTCCGGGCGCACGTCCCTTTAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PROKR2 (128674)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477022
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 128674 | PROKR2 | prokineticin receptor 2 | NM_144773.3 | 99.9% | 99.7% | 978C>A |
| 2 | human | 128674 | PROKR2 | prokineticin receptor 2 | XM_017027646.1 | 99.9% | 99.7% | 978C>A |
| 3 | human | 10887 | PROKR1 | prokineticin receptor 1 | NM_138964.3 | 82.4% | 84.7% | (many diffs) |
| 4 | mouse | 246313 | Prokr2 | prokineticin receptor 2 | NM_144944.3 | 85.6% | 89.3% | (many diffs) |
| 5 | mouse | 246313 | Prokr2 | prokineticin receptor 2 | XM_011239555.2 | 85.6% | 89.3% | (many diffs) |
| 6 | mouse | 246313 | Prokr2 | prokineticin receptor 2 | XM_011239558.2 | 49% | 51.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1221
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcgccat ggcagcccag aatggaaaca ccagtttcac acccaacttt aatccacccc 121 aagaccatgc ctcctccctc tcctttaact tcagttatgg tgattatgac ctccctatgg 181 atgaggatga ggacatgacc aagacccgga ccttcttcgc agccaagatc gtcattggca 241 ttgcactggc aggcatcatg ctggtctgcg gcatcggtaa ctttgtcttt atcgctgccc 301 tcacccgcta taagaagttg cgcaacctca ccaatctgct cattgccaac ctggccatct 361 ccgacttcct ggtggccatc atctgctgcc ccttcgagat ggactactac gtggtacggc 421 agctctcctg ggagcatggc cacgtgctct gtgcctccgt caactacctg cgcaccgtct 481 ccctctacgt ctccaccaat gccttgctgg ccattgccat tgacagatat ctcgccatcg 541 ttcacccctt gaaaccacgg atgaattatc aaacggcctc cttcctgatc gccttggtct 601 ggatggtgtc cattctcatt gccatcccat cggcttactt tgcaacagaa acggtcctct 661 ttattgtcaa gagccaggag aagatcttct gtggccagat ctggcctgtg gatcagcagc 721 tctactacaa gtcctacttc ctcttcatct ttggtgtcga gttcgtgggc cctgtggtca 781 ccatgaccct gtgctatgcc aggatctccc gggagctctg gttcaaggca gtccctgggt 841 tccagacgga gcagattcgc aagcggctgc gctgccgcag gaagacggtc ctggtgctca 901 tgtgcattct cacggcctat gtgctgtgct gggcaccctt cTACGGTTTC ACCATCGTTC 961 GTGACTTCTT CCCCACTGTG TTCGTGAAGG AAAAGCACTA CCTCACTGCC TTCTACGTGG 1021 TCGAGTGCAT CGCCATGAGC AACAGAATGA TCAACACCGT GTGCTTCGTG ACGGTCAAGA 1081 ACAACACCAT GAAGTACTTC AAGAAGATGA TGCTGCTGCA CTGGCGTCCC TCCCAGCGGG 1141 GGAGCAAGTC CAGTGCTGAC CTTGACCTCA GAACCAACGG GGTGCCCACC ACAGAAGAGG 1201 TGGACTGTAT CAGGCTGAAG TTGCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1261 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1321 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATTCC GGGCGCACGT 1381 CCCTTTAAGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt