Transcript: Mouse NM_144944.3

Mus musculus prokineticin receptor 2 (Prokr2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Prokr2 (246313)
Length:
4533
CDS:
323..1468

Additional Resources:

NCBI RefSeq record:
NM_144944.3
NBCI Gene record:
Prokr2 (246313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144944.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028715 GCTCTACTACAAATCCTACTT pLKO.1 964 CDS 100% 4.950 3.960 N Prokr2 n/a
2 TRCN0000028744 CCGTTCTATGGCTTTACCATA pLKO.1 1181 CDS 100% 0.495 0.396 N Prokr2 n/a
3 TRCN0000367766 TTGAAACCACGGATGAATTAT pLKO_005 794 CDS 100% 15.000 10.500 N PROKR2 n/a
4 TRCN0000028667 CCCAAGACCATGTCTCCTTAA pLKO.1 372 CDS 100% 10.800 7.560 N Prokr2 n/a
5 TRCN0000028706 AGGTGGATTGTATCAGACTAA pLKO.1 1443 CDS 100% 4.950 3.465 N Prokr2 n/a
6 TRCN0000028746 CCACAGAAACCATCCTCGTTA pLKO.1 888 CDS 100% 4.950 3.465 N Prokr2 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3862 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144944.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488075 AAGTAATATTACAGGTATATAGTC pLX_317 25% 85.6% 89.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488657 ACATACCACTAATGTCTGGCCCCT pLX_317 24.8% 85.6% 89.3% V5 (many diffs) n/a
3 ccsbBroadEn_09515 pDONR223 100% 85.6% 89.3% None (many diffs) n/a
4 ccsbBroad304_09515 pLX_304 0% 85.6% 89.3% V5 (many diffs) n/a
5 TRCN0000477022 TTCCGGGCGCACGTCCCTTTAAGT pLX_317 24.6% 85.6% 89.3% V5 (many diffs) n/a
Download CSV