Construct: ORF TRCN0000477029
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006073.1_s317c1
- Derived from:
- ccsbBroadEn_02799
- DNA Barcode:
- ATCTGGTGCATGCCCCGTTTCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DDAH1 (23576)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477029
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | NM_012137.4 | 100% | 100% | |
| 2 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | XM_017000889.1 | 66.9% | 63% | (many diffs) |
| 3 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | NM_001330655.2 | 64.7% | 64.5% | 0_1ins301;2delT |
| 4 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | XM_011541158.1 | 64.7% | 64.5% | 0_1ins301;2delT |
| 5 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | XM_005270707.2 | 64.5% | 64.5% | (many diffs) |
| 6 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | NM_001134445.2 | 63.8% | 63.8% | 0_1ins309 |
| 7 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | XM_005270710.2 | 63.8% | 63.8% | 0_1ins309 |
| 8 | human | 23576 | DDAH1 | dimethylarginine dimethylam... | XM_024446130.1 | 63.8% | 63.8% | 0_1ins309 |
| 9 | mouse | 69219 | Ddah1 | dimethylarginine dimethylam... | NM_026993.3 | 89.2% | 93.6% | (many diffs) |
| 10 | mouse | 69219 | Ddah1 | dimethylarginine dimethylam... | XM_017319712.1 | 61.3% | 59.9% | (many diffs) |
| 11 | mouse | 69219 | Ddah1 | dimethylarginine dimethylam... | XM_011240221.2 | 56.7% | 61% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 921
- ORF length:
- 855
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgggctcggc caccccgccg ccttcggccg ggccacccac gccgtggtgc 121 gggcgctacc cgagtcgctc ggccagcacg cgctgagaag cgccaagggc gaggaggtgg 181 acgtcgcccg cgcggaacgg cagcaccagc tctacgtggg cgtgctgggc agcaagctgg 241 ggctgcaggt ggtggagctg ccggccgacg agagccttcc ggactgcgtc ttcgtggagg 301 acgtggccgt ggtgtgcgag gagacggccc tcatcacccg acccggggcg ccgagccgga 361 ggaaggaggt tgacatgatg aaagaagcat tagaaaaact tcagctcaat atagtagaga 421 tgaaagatga aaatgcaact ttagatggcg gagatgtttt attcacaggc agagaatttt 481 ttgtgggcct ttccaaaagg acaaatcaac gaggtgctga aatcttggct gatactttta 541 agGACTATGC AGTCTCCACA GTGCCAGTGG CAGATGGGTT GCATTTGAAG AGTTTCTGCA 601 GCATGGCTGG GCCTAACCTG ATCGCAATTG GGTCTAGTGA ATCTGCACAG AAGGCCCTTA 661 AGATCATGCA ACAGATGAGT GACCACCGCT ACGACAAACT CACTGTGCCT GATGACATAG 721 CAGCAAACTG TATATATCTA AATATCCCCA ACAAAGGGCA CGTCTTGCTG CACCGAACCC 781 CGGAAGAGTA TCCAGAAAGT GCAAAGGTTT ATGAGAAACT GAAGGACCAT ATGCTGATCC 841 CCGTGAGCAT GTCTGAACTG GAAAAGGTGG ATGGGCTGCT CACCTGCTGC TCAGTTTTAA 901 TTAACAAGAA AGTAGACTCC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAATCT GGTGCATGCC 1081 CCGTTTCTTC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt