Transcript: Mouse XM_011240221.2

PREDICTED: Mus musculus dimethylarginine dimethylaminohydrolase 1 (Ddah1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ddah1 (69219)
Length:
3298
CDS:
31..579

Additional Resources:

NCBI RefSeq record:
XM_011240221.2
NBCI Gene record:
Ddah1 (69219)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011240221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101691 GCTCAACATAGTAGAGATGAA pLKO.1 60 CDS 100% 4.950 3.960 N Ddah1 n/a
2 TRCN0000323761 GCTCAACATAGTAGAGATGAA pLKO_005 60 CDS 100% 4.950 3.960 N Ddah1 n/a
3 TRCN0000101693 TGGCCGATTCTTTGCATTTAA pLKO.1 224 CDS 100% 15.000 10.500 N Ddah1 n/a
4 TRCN0000323691 TGGCCGATTCTTTGCATTTAA pLKO_005 224 CDS 100% 15.000 10.500 N Ddah1 n/a
5 TRCN0000051866 CTGAAATCTTGGCTGATACTT pLKO.1 173 CDS 100% 5.625 3.938 N DDAH1 n/a
6 TRCN0000300763 CTGAAATCTTGGCTGATACTT pLKO_005 173 CDS 100% 5.625 3.938 N DDAH1 n/a
7 TRCN0000101690 CCTCAAGATCATGCAACAGAT pLKO.1 312 CDS 100% 4.950 3.465 N Ddah1 n/a
8 TRCN0000323759 CCTCAAGATCATGCAACAGAT pLKO_005 312 CDS 100% 4.950 3.465 N Ddah1 n/a
9 TRCN0000101692 GTGCTGAAATCTTGGCTGATA pLKO.1 170 CDS 100% 4.950 3.465 N Ddah1 n/a
10 TRCN0000323689 GTGCTGAAATCTTGGCTGATA pLKO_005 170 CDS 100% 4.950 3.465 N Ddah1 n/a
11 TRCN0000101694 GAGAAACTCAAGGACCATCTA pLKO.1 469 CDS 100% 4.950 2.970 N Ddah1 n/a
12 TRCN0000323758 GAGAAACTCAAGGACCATCTA pLKO_005 469 CDS 100% 4.950 2.970 N Ddah1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011240221.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02799 pDONR223 100% 56.7% 61% None (many diffs) n/a
2 TRCN0000477029 ATCTGGTGCATGCCCCGTTTCTTC pLX_317 44.4% 56.7% 61% V5 (many diffs) n/a
Download CSV