Transcript: Human XM_005270710.2

PREDICTED: Homo sapiens dimethylarginine dimethylaminohydrolase 1 (DDAH1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DDAH1 (23576)
Length:
3914
CDS:
399..947

Additional Resources:

NCBI RefSeq record:
XM_005270710.2
NBCI Gene record:
DDAH1 (23576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051866 CTGAAATCTTGGCTGATACTT pLKO.1 541 CDS 100% 5.625 3.938 N DDAH1 n/a
2 TRCN0000300763 CTGAAATCTTGGCTGATACTT pLKO_005 541 CDS 100% 5.625 3.938 N DDAH1 n/a
3 TRCN0000051867 CCTTAAGATCATGCAACAGAT pLKO.1 680 CDS 100% 4.950 3.465 N DDAH1 n/a
4 TRCN0000300762 CCTTAAGATCATGCAACAGAT pLKO_005 680 CDS 100% 4.950 3.465 N DDAH1 n/a
5 TRCN0000051863 GCTCAATATAGTAGAGATGAA pLKO.1 428 CDS 100% 4.950 3.465 N DDAH1 n/a
6 TRCN0000051864 GTCTAGTGAATCTGCACAGAA pLKO.1 656 CDS 100% 4.950 3.465 N DDAH1 n/a
7 TRCN0000331674 GTCTAGTGAATCTGCACAGAA pLKO_005 656 CDS 100% 4.950 3.465 N DDAH1 n/a
8 TRCN0000051865 TGAGCATGTCTGAACTGGAAA pLKO.1 868 CDS 100% 4.950 3.465 N DDAH1 n/a
9 TRCN0000300840 TGAGCATGTCTGAACTGGAAA pLKO_005 868 CDS 100% 4.950 3.465 N DDAH1 n/a
10 TRCN0000101692 GTGCTGAAATCTTGGCTGATA pLKO.1 538 CDS 100% 4.950 2.970 N Ddah1 n/a
11 TRCN0000323689 GTGCTGAAATCTTGGCTGATA pLKO_005 538 CDS 100% 4.950 2.970 N Ddah1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270710.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02799 pDONR223 100% 63.8% 63.8% None 0_1ins309 n/a
2 TRCN0000477029 ATCTGGTGCATGCCCCGTTTCTTC pLX_317 44.4% 63.8% 63.8% V5 0_1ins309 n/a
Download CSV