Construct: ORF TRCN0000477058
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003324.1_s317c1
- Derived from:
- ccsbBroadEn_04086
- DNA Barcode:
- TATGTTTATTTGCGACGGAGTTGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCTN1 (79600)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477058
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001082537.3 | 100% | 100% | |
| 2 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001082538.3 | 99.1% | 99.1% | 1493_1507del |
| 3 | human | 79600 | TCTN1 | tectonic family member 1 | NM_024549.6 | 95.3% | 92.6% | (many diffs) |
| 4 | human | 79600 | TCTN1 | tectonic family member 1 | XM_011538733.3 | 94.5% | 91.8% | (many diffs) |
| 5 | human | 79600 | TCTN1 | tectonic family member 1 | XM_011538734.3 | 93.6% | 93% | (many diffs) |
| 6 | human | 79600 | TCTN1 | tectonic family member 1 | XR_944717.3 | 91.6% | 1_54del;1545_1558del;1830_1921del | |
| 7 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001319680.2 | 91.6% | 91.6% | 1190_1191ins147 |
| 8 | human | 79600 | TCTN1 | tectonic family member 1 | XM_011538735.2 | 90.8% | 90.8% | 1190_1191ins147;1346_1360del |
| 9 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001173975.3 | 88.7% | 87% | (many diffs) |
| 10 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719594.3 | 88% | 86.2% | (many diffs) |
| 11 | human | 79600 | TCTN1 | tectonic family member 1 | XM_011538737.3 | 86.4% | 79.7% | 1102_1103ins227;1264_1277del |
| 12 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001173976.2 | 80.5% | 77.5% | (many diffs) |
| 13 | human | 79600 | TCTN1 | tectonic family member 1 | XM_017019964.1 | 80.4% | 78.7% | (many diffs) |
| 14 | human | 79600 | TCTN1 | tectonic family member 1 | XR_243021.4 | 80.4% | 1_54del;1156_1157ins227;1589_1680del | |
| 15 | human | 79600 | TCTN1 | tectonic family member 1 | XR_429116.3 | 79.8% | (many diffs) | |
| 16 | human | 79600 | TCTN1 | tectonic family member 1 | XM_011538738.3 | 79.3% | 73.6% | 976_977ins353;1138_1151del |
| 17 | human | 79600 | TCTN1 | tectonic family member 1 | XR_243022.4 | 73.8% | 1_54del;1030_1031ins353;1463_1554del | |
| 18 | human | 79600 | TCTN1 | tectonic family member 1 | XM_005253934.4 | 71.4% | 71.2% | (many diffs) |
| 19 | human | 79600 | TCTN1 | tectonic family member 1 | XM_005253935.4 | 70.6% | 70.6% | 976_977ins516 |
| 20 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001319681.2 | 69.6% | 69.6% | 0_1ins534 |
| 21 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719595.3 | 69% | 69% | 0_1ins534;959_973del |
| 22 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719596.3 | 69% | 69% | 0_1ins534;959_973del |
| 23 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719597.4 | 69% | 69% | 0_1ins534;959_973del |
| 24 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719598.3 | 69% | 69% | 0_1ins534;959_973del |
| 25 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719599.3 | 69% | 69% | 0_1ins534;959_973del |
| 26 | human | 79600 | TCTN1 | tectonic family member 1 | XM_006719600.3 | 69% | 69% | 0_1ins534;959_973del |
| 27 | human | 79600 | TCTN1 | tectonic family member 1 | XM_017019966.2 | 69% | 69% | 0_1ins534;959_973del |
| 28 | human | 79600 | TCTN1 | tectonic family member 1 | XM_017019968.2 | 69% | 69% | 0_1ins534;959_973del |
| 29 | human | 79600 | TCTN1 | tectonic family member 1 | XM_017019969.2 | 64.6% | 62.3% | (many diffs) |
| 30 | human | 79600 | TCTN1 | tectonic family member 1 | NR_135088.2 | 59.8% | (many diffs) | |
| 31 | human | 79600 | TCTN1 | tectonic family member 1 | NM_001319682.2 | 29.5% | 25.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1830
- ORF length:
- 1761
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaggccgcga ggtctcccgc cgctcctggt ggtgctcctg ggctgctggg 121 cctccgtgag cgcccagacc gatgccaccc cggcggtgac gacagagggc ctcaactcca 181 ccgaggcagc cctggccacc ttcggaactt tcccgtcgac caggcccccc gggactccca 241 gggctccagg gccctcctcc ggccccaggc ctaccccagt cacggacgtt gctgttctct 301 gtgtctgtga cttatcccca gcacagtgtg acatcaactg ctgctgtgat cccgactgca 361 gctccgtgga tttcagtgtc ttttctgcct gctcagttcc agttgtcacg ggcgacagcc 421 agttttgtag tcaaaaagca gtcatctatt cattgaattt tacagcaaac ccacctcaaa 481 gagtatttga acttgttgac cagattaatc catctatttt ctgcattcat attacaaact 541 ataaacctgc attatccttt attaatccag aagtacctga tgaaaacaat tttgatacat 601 tgatgaaaac atctgatggt tttacattga atgctgaatc atatgtttcc ttcacaacca 661 aactggatat tcctactgct gctaaatatg agtatggggt tcctctgcag acttcagatt 721 cgtttctgag atttccttcg tccctgacat catctctgtg cactgataat aaccctgcag 781 cgtttctggt gaaccaggct gttaagtgca ccagaaaaat aaatttagaa cagtgtgaag 841 aaattgaagc cctcagcatg gctttttaca gcagcccgga aattctgagg gtacctgatt 901 caagaaaaaa ggtccctatc actgttcagt ccatcgtcat tcagtctcta aataaaacgc 961 tcacccgacg ggaggacact gatgtgctgc agccgactct cgtcaacgct ggacacttta 1021 gcctttgcgt gaatgttgtt cttgaggtaa agtacagcct cacatacaca gatgcaggtg 1081 aagtcaccaa agctgatctc tcattcgttc tggggacagt tagcagcgta gtggtcccac 1141 tgcagcaaaa gtttgaaatt cattttcttc aggaaaatac ccagccagtc cctctcagtg 1201 gaaaccctgg ttatgtcgtg gggctcccat tagctgctgg attccagcct cataaggggt 1261 ctgggattat tcagaccaca aatagatatg gacagcttac tattcttcat agcacaactg 1321 agcaagactg cttagcactg gagggggtcc ggaccccagt attatttggt tacactatgc 1381 aatctggctg taaactaaga ctgactggag ctctcccgtg tcagctcgta gcacagaagg 1441 tgaagagcct gctgtggggc cagggcttcc cagattacgt ggcccctttt ggaaattccc 1501 aggcccagga catgctggac tggGTGCCCA TCCACTTCAT CACCCAGTCA TTCAACAGGA 1561 AGGATTCCTG CCAGCTCCCA GGGGCTTTGG TTATAGAAGT GAAGTGGACT AAATACGGAT 1621 CCCTGCTGAA TCCACAGGCC AAAATAGTCA ATGTAACTGC AAATCTAATT TCATCCTCCT 1681 TTCCTGAGGC CAACTCAGGA AATGAAAGGA CGATTCTTAT TTCCACTGCG GTTACTTTTG 1741 TGGATGTGTC TGCACCTGCA GAGGCAGGCT TCAGAGCTCC ACCAGCCATC AATGCCAGGC 1801 TGCCCTTTAA CTTCTTCTTC CCGTTTGTTT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1861 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1921 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGATATGT 1981 TTATTTGCGA CGGAGTTGAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2041 tgaaagatt