Transcript: Human XM_017019968.2

PREDICTED: Homo sapiens tectonic family member 1 (TCTN1), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCTN1 (79600)
Length:
1789
CDS:
456..1700

Additional Resources:

NCBI RefSeq record:
XM_017019968.2
NBCI Gene record:
TCTN1 (79600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144255 CAGATGCATCAGTTCCTTAAT pLKO.1 1708 3UTR 100% 13.200 10.560 N TCTN1 n/a
2 TRCN0000141681 CCCTATCACTGTTCAGTCCAT pLKO.1 767 CDS 100% 2.640 2.112 N TCTN1 n/a
3 TRCN0000143735 GATTCTTATTTCCACTGCGGT pLKO.1 1580 CDS 100% 0.660 0.528 N TCTN1 n/a
4 TRCN0000143882 CAATGCTCAGATGCATCAGTT pLKO.1 1701 CDS 100% 4.950 3.465 N TCTN1 n/a
5 TRCN0000122338 CCACTTCATCACCCAGTCATT pLKO.1 1385 CDS 100% 4.950 3.465 N TCTN1 n/a
6 TRCN0000142994 CTCAGATGCATCAGTTCCTTA pLKO.1 1706 3UTR 100% 4.950 3.465 N TCTN1 n/a
7 TRCN0000144543 CTTTGCGTGAATGTTGTTCTT pLKO.1 876 CDS 100% 4.950 3.465 N TCTN1 n/a
8 TRCN0000122419 GCTCAGATGCATCAGTTCCTT pLKO.1 1705 3UTR 100% 3.000 2.100 N TCTN1 n/a
9 TRCN0000292509 GCTCAGATGCATCAGTTCCTT pLKO_005 1705 3UTR 100% 3.000 2.100 N TCTN1 n/a
10 TRCN0000122363 CTCAGGAAATGAAAGGACGAT pLKO.1 1562 CDS 100% 2.640 1.848 N TCTN1 n/a
11 TRCN0000144087 CTTTAACTTCTTCTTCCCGTT pLKO.1 1673 CDS 100% 2.160 1.512 N TCTN1 n/a
12 TRCN0000121763 CCTCAAAGAGTATTTGAACTT pLKO.1 154 5UTR 100% 0.495 0.347 N TCTN1 n/a
13 TRCN0000292510 CCTCAAAGAGTATTTGAACTT pLKO_005 154 5UTR 100% 0.495 0.347 N TCTN1 n/a
14 TRCN0000143968 CTTCAGATTCGTTTCTGAGAT pLKO.1 565 CDS 100% 0.495 0.347 N TCTN1 n/a
15 TRCN0000297995 CTTCAGATTCGTTTCTGAGAT pLKO_005 565 CDS 100% 0.495 0.347 N TCTN1 n/a
16 TRCN0000143655 CAAACCCACCTCAAAGAGTAT pLKO.1 146 5UTR 100% 4.950 2.970 N TCTN1 n/a
17 TRCN0000142834 CCTTCACAACCAAACTGGATA pLKO.1 502 CDS 100% 4.950 2.970 N TCTN1 n/a
18 TRCN0000292511 CCTTCACAACCAAACTGGATA pLKO_005 502 CDS 100% 4.950 2.970 N TCTN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019968.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04086 pDONR223 100% 69% 69% None 0_1ins534;959_973del n/a
2 ccsbBroad304_04086 pLX_304 0% 69% 69% V5 0_1ins534;959_973del n/a
3 TRCN0000477058 TATGTTTATTTGCGACGGAGTTGA pLX_317 17.7% 69% 69% V5 0_1ins534;959_973del n/a
Download CSV