Construct: ORF TRCN0000477078
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018060.1_s317c1
- Derived from:
- ccsbBroadEn_09798
- DNA Barcode:
- CTCGCCTAAGTTTGTTGCCTGCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- THAP8 (199745)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477078
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 199745 | THAP8 | THAP domain containing 8 | NM_152658.3 | 99.8% | 99.6% | 469C>T |
| 2 | human | 199745 | THAP8 | THAP domain containing 8 | NM_001331102.1 | 84.9% | 84.6% | 469C>T;548_549ins123 |
| 3 | human | 199745 | THAP8 | THAP domain containing 8 | NM_001331103.1 | 84.1% | 83.9% | 0_1ins129;340C>T |
| 4 | human | 199745 | THAP8 | THAP domain containing 8 | NM_001331104.1 | 84.1% | 83.9% | 0_1ins129;340C>T |
| 5 | human | 199745 | THAP8 | THAP domain containing 8 | NR_138539.1 | 34.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 891
- ORF length:
- 822
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcccaagtac tgcagggcgc cgaactgctc caacactgcg ggccgcctgg 121 gtgcagacaa ccgccctgtg agcttctaca agttcccact gaaggatggt ccccggctgc 181 aggcctggct gcagcacatg ggctgtgagc actgggtgcc cagctgccac cagcacttgt 241 gcagcgagca cttcacaccc tcctgcttcc agtggcgctg gggtgtgcgc tacctgcggc 301 ctgatgcagt gccctccatc ttctcccggg gaccacctgc caagagtcag cggaggaccc 361 gaagcaccca gaagccagtc tcgccgccgc ctcccctaca gaagaataca cccctgcccc 421 agagccctgc catcccagtc tctggcccag tgcgcctagt ggtgctgggc cccacatcgg 481 ggagccccaa gactgtggcc accatgctcc tgacccccct ggcccctgcg ccaacttcTG 541 AGCGGTCACA ACCTGAAGTC CCTGCCCAAC AGGCCCAGAC CGGGCTGGGC CCAGTGCTGG 601 GAGCACTGCA ACGCCGGGTG CGGAGGCTGC AACGGTGCCA GGAGCGGCAC CAGGCGCAGC 661 TGCAGGCCCT GGAACGGCTG GCACAGCAGC TACACGGGGA GAGCCTGCTG GCACGGGCAC 721 GCCGGGGTCT GCAGCGCCTG ACAACAGCCC AGACCCTTGG ACCTGAGGAA TCCCAAACCT 781 TCACCATCAT CTGTGGAGGG CCTGACATAG CCATGGTCCT TGCCCAGGAC CCTGCACCTG 841 CCACAGTGGA TGCCAAGCCG GAGCTCCTGG ACACTCGGAT CCCCAGTGCA TTGCCAACTT 901 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 961 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1021 CTTGTGGAAA GGACGACTCG CCTAAGTTTG TTGCCTGCTG ACGCGTTAAG TCgacaatca 1081 acctctggat tacaaaattt gtgaaagatt