Transcript: Human NM_001331103.1

Homo sapiens THAP domain containing 8 (THAP8), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
THAP8 (199745)
Length:
1811
CDS:
661..1356

Additional Resources:

NCBI RefSeq record:
NM_001331103.1
NBCI Gene record:
THAP8 (199745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434983 GCACTTGTGCAGCGAGCACTT pLKO_005 696 CDS 100% 1.350 1.890 N THAP8 n/a
2 TRCN0000422960 TAAGGATCAAGACAGACAATG pLKO_005 1354 CDS 100% 10.800 7.560 N THAP8 n/a
3 TRCN0000150852 GAGAATCATACCTGGTTCTAA pLKO.1 1645 3UTR 100% 5.625 3.938 N THAP8 n/a
4 TRCN0000154592 GATAGAAGATGGAGGAGGAAA pLKO.1 1388 3UTR 100% 4.950 3.465 N THAP8 n/a
5 TRCN0000158204 CCTAGGGATCTCTTGAACCTT pLKO.1 1499 3UTR 100% 3.000 2.100 N THAP8 n/a
6 TRCN0000422950 GATCTTTGCAAATCAGTACGA pLKO_005 1594 3UTR 100% 2.640 1.848 N THAP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05179 pDONR223 100% 84.3% 84.3% None 0_1ins129 n/a
2 ccsbBroad304_05179 pLX_304 0% 84.3% 84.3% V5 0_1ins129 n/a
3 TRCN0000480920 AGATATCTTATCCTTTTCTTTAAG pLX_317 43.1% 84.3% 84.3% V5 0_1ins129 n/a
4 ccsbBroadEn_09798 pDONR223 100% 84.1% 83.9% None 0_1ins129;340C>T n/a
5 ccsbBroad304_09798 pLX_304 0% 84.1% 83.9% V5 0_1ins129;340C>T n/a
6 TRCN0000477078 CTCGCCTAAGTTTGTTGCCTGCTG pLX_317 42.9% 84.1% 83.9% V5 0_1ins129;340C>T n/a
Download CSV