Transcript: Human NR_138539.1

Homo sapiens THAP domain containing 8 (THAP8), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
THAP8 (199745)
Length:
1632
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_138539.1
NBCI Gene record:
THAP8 (199745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_138539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422960 TAAGGATCAAGACAGACAATG pLKO_005 1175 3UTR 100% 10.800 7.560 N THAP8 n/a
2 TRCN0000150852 GAGAATCATACCTGGTTCTAA pLKO.1 1466 3UTR 100% 5.625 3.938 N THAP8 n/a
3 TRCN0000154592 GATAGAAGATGGAGGAGGAAA pLKO.1 1209 3UTR 100% 4.950 3.465 N THAP8 n/a
4 TRCN0000158204 CCTAGGGATCTCTTGAACCTT pLKO.1 1320 3UTR 100% 3.000 2.100 N THAP8 n/a
5 TRCN0000422950 GATCTTTGCAAATCAGTACGA pLKO_005 1415 3UTR 100% 2.640 1.848 N THAP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_138539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05179 pDONR223 100% 34.4% None 1_545del;628_629ins193;1175_1632del n/a
2 ccsbBroad304_05179 pLX_304 0% 34.4% V5 1_545del;628_629ins193;1175_1632del n/a
3 TRCN0000480920 AGATATCTTATCCTTTTCTTTAAG pLX_317 43.1% 34.4% V5 1_545del;628_629ins193;1175_1632del n/a
4 ccsbBroadEn_09798 pDONR223 100% 34.4% None (many diffs) n/a
5 ccsbBroad304_09798 pLX_304 0% 34.4% V5 (many diffs) n/a
6 TRCN0000477078 CTCGCCTAAGTTTGTTGCCTGCTG pLX_317 42.9% 34.4% V5 (many diffs) n/a
Download CSV