Construct: ORF TRCN0000477084
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003470.1_s317c1
- Derived from:
- ccsbBroadEn_12363
- DNA Barcode:
- CTGGACCCTTTCAGCGTGTATAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NCEH1 (57552)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477084
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57552 | NCEH1 | neutral cholesterol ester h... | NM_020792.6 | 100% | 100% | |
| 2 | human | 57552 | NCEH1 | neutral cholesterol ester h... | NM_001146276.3 | 98% | 97.8% | 368_391del |
| 3 | human | 57552 | NCEH1 | neutral cholesterol ester h... | NM_001146277.3 | 67.4% | 67.4% | 0_1ins399 |
| 4 | human | 57552 | NCEH1 | neutral cholesterol ester h... | NM_001146278.2 | 67.4% | 67.4% | 0_1ins399 |
| 5 | mouse | 320024 | Nceh1 | neutral cholesterol ester h... | NM_178772.3 | 82.8% | 87.5% | (many diffs) |
| 6 | mouse | 320024 | Nceh1 | neutral cholesterol ester h... | XM_011249684.1 | 55.7% | 59.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1290
- ORF length:
- 1224
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag gtcgtcctgt gtcctgctca ccgccctggt ggcgctggcc gcctattacg 121 tctacatccc gctgcctggc tccgtgtccg acccctggaa gctgatgctg ctggacgcca 181 ctttccgggg tgcacagcaa gtgagtaacc tgatccacta cctgggactg agccatcacc 241 tgctggcact gaattttatc attgtttctt ttggcaaaaa aagcgcgtgg tcttctgccc 301 aagtgaaggt gaccgacaca gactttgatg gtgtggaagt cagagtgttt gaaggccctc 361 cgaagcccga agagccactg aaacgcagcg tcgtttatat ccacggagga ggctgggcct 421 tggcaagtgc aaaaatcagg tattatgatg agctgtgtac agcaatggct gaggaattga 481 atgctgtcat tgtttccatt gaatacaggc tagttccaaa ggtttatttt cctgagcaaa 541 ttcatgatgt tgtacgggcc acaaagtatt tcctgaagcc agaagtctta cagaagtata 601 tggttgatcc aggcagaatt tgcatttctg gtgacagtgc tggtggaaat ctggctgctg 661 cccttggaca acagtttact caagatgcca gcctaaaaaa taagctcaaa ctacaagctt 721 taatttatcc agttcttcaa gctttagatt ttaacacacc atcttatcag caaaatgtga 781 acaccccaat cctgccccgc tatgtcatgg tgaagtattg ggtggactac ttcaaaggca 841 actatgactt tgtgcaggca atgatcgtta acaatcacac ttcacttgat gtggaagagg 901 ctgctgctgt cagggcccgt ctaaactgga catccctctt gccTGCATCC TTCACAAAGA 961 ACTACAAGCC TGTTGTACAG ACCACAGGCA ATGCCAGGAT TGTCCAGGAG CTTCCTCAGT 1021 TGCTGGATGC CCGCTCCGCC CCACTCATTG CAGACCAGGC AGTGCTGCAG CTCCTCCCAA 1081 AGACCTACAT TCTGACGTGT GAGCATGATG TCCTCAGAGA CGATGGCATC ATGTATGCCA 1141 AGCGTTTGGA GAGTGCCGGT GTGGAGGTGA CCCTGGATCA CTTTGAGGAT GGCTTTCACG 1201 GATGTATGAT TTTCACTAGC TGGCCCACCA ACTTCTCAGT GGGAATCCGG ACTAGGAATA 1261 GTTACATCAA GTGGCTAGAT CAAAACCTGT ACCCAACTTT CTTGTACAAA GTGGTTGATA 1321 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1381 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGACTGGA 1441 CCCTTTCAGC GTGTATAAGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1501 tgaaagatt