Transcript: Mouse XM_011249684.1

PREDICTED: Mus musculus neutral cholesterol ester hydrolase 1 (Nceh1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nceh1 (320024)
Length:
4541
CDS:
266..1093

Additional Resources:

NCBI RefSeq record:
XM_011249684.1
NBCI Gene record:
Nceh1 (320024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011249684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012019 CCGGACTAGGAATAGTTACAT pLKO.1 1048 CDS 100% 5.625 4.500 N Nceh1 n/a
2 TRCN0000012022 GAGGCCATGATTGTGAACAAT pLKO.1 656 CDS 100% 5.625 3.938 N Nceh1 n/a
3 TRCN0000012018 CCTCTTCCAATGTTAGTCTTT pLKO.1 3247 3UTR 100% 4.950 3.465 N Nceh1 n/a
4 TRCN0000012021 GCGTCATGTCATGGTTAGGTA pLKO.1 598 CDS 100% 3.000 2.100 N Nceh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011249684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12363 pDONR223 100% 55.7% 59.3% None (many diffs) n/a
2 ccsbBroad304_12363 pLX_304 0% 55.7% 59.3% V5 (many diffs) n/a
3 TRCN0000477084 CTGGACCCTTTCAGCGTGTATAAG pLX_317 28.6% 55.7% 59.3% V5 (many diffs) n/a
Download CSV