Transcript: Human NM_001146276.3

Homo sapiens neutral cholesterol ester hydrolase 1 (NCEH1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
NCEH1 (57552)
Length:
4560
CDS:
84..1334

Additional Resources:

NCBI RefSeq record:
NM_001146276.3
NBCI Gene record:
NCEH1 (57552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303794 TGTTATCTTAGCCAACTATAC pLKO_005 1571 3UTR 100% 10.800 15.120 N NCEH1 n/a
2 TRCN0000012019 CCGGACTAGGAATAGTTACAT pLKO.1 1289 CDS 100% 5.625 7.875 N Nceh1 n/a
3 TRCN0000072429 CGCTATGTCATGGTGAAGTAT pLKO.1 840 CDS 100% 5.625 7.875 N NCEH1 n/a
4 TRCN0000072430 GCTATGTCATGGTGAAGTATT pLKO.1 841 CDS 100% 13.200 9.240 N NCEH1 n/a
5 TRCN0000300060 GCTATGTCATGGTGAAGTATT pLKO_005 841 CDS 100% 13.200 9.240 N NCEH1 n/a
6 TRCN0000310776 TATCCAGTTCTTCAAGCTTTA pLKO_005 768 CDS 100% 10.800 7.560 N NCEH1 n/a
7 TRCN0000072431 CTGTCATTGTTTCCATTGAAT pLKO.1 526 CDS 100% 5.625 3.938 N NCEH1 n/a
8 TRCN0000300061 CTGTCATTGTTTCCATTGAAT pLKO_005 526 CDS 100% 5.625 3.938 N NCEH1 n/a
9 TRCN0000072428 CCTCTCCTTATGTGGTGGTTT pLKO.1 3334 3UTR 100% 4.950 3.465 N NCEH1 n/a
10 TRCN0000072432 CCTGAGCAAATTCATGATGTT pLKO.1 573 CDS 100% 4.950 3.465 N NCEH1 n/a
11 TRCN0000300059 CCTGAGCAAATTCATGATGTT pLKO_005 573 CDS 100% 4.950 3.465 N NCEH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146276.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12363 pDONR223 100% 98% 97.8% None 368_391del n/a
2 ccsbBroad304_12363 pLX_304 0% 98% 97.8% V5 368_391del n/a
3 TRCN0000477084 CTGGACCCTTTCAGCGTGTATAAG pLX_317 28.6% 98% 97.8% V5 368_391del n/a
Download CSV