Construct: ORF TRCN0000477143
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007845.1_s317c1
- Derived from:
- ccsbBroadEn_07047
- DNA Barcode:
- CATGCCGTTTCGGGTGAGCACCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TMBIM6 (7009)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477143
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | NM_003217.3 | 99.8% | 99.5% | 452T>C |
| 2 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_024449169.1 | 99.8% | 99.5% | 452T>C |
| 3 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_024449170.1 | 99.8% | 99.5% | 452T>C |
| 4 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_024449171.1 | 99.8% | 99.5% | 452T>C |
| 5 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_024449172.1 | 99.8% | 99.5% | 452T>C |
| 6 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_024449173.1 | 99.8% | 99.5% | 452T>C |
| 7 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_024449174.1 | 99.8% | 99.5% | 452T>C |
| 8 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | NM_001098576.1 | 80.2% | 80% | 1_174del;626T>C |
| 9 | human | 7009 | TMBIM6 | transmembrane BAX inhibitor... | XM_005269126.4 | 80.2% | 80% | 1_174del;626T>C |
| 10 | mouse | 110213 | Tmbim6 | transmembrane BAX inhibitor... | NM_001171034.1 | 86% | 93.6% | (many diffs) |
| 11 | mouse | 110213 | Tmbim6 | transmembrane BAX inhibitor... | NM_001171035.1 | 86% | 93.6% | (many diffs) |
| 12 | mouse | 110213 | Tmbim6 | transmembrane BAX inhibitor... | NM_001171036.1 | 86% | 93.6% | (many diffs) |
| 13 | mouse | 110213 | Tmbim6 | transmembrane BAX inhibitor... | NM_026669.4 | 86% | 93.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 777
- ORF length:
- 711
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa catatttgat cgaaagatca actttgatgc gcttttaaaa ttttctcata 121 taaccccgtc aacgcagcag cacctgaaga aggtctatgc aagttttgcc ctttgtatgt 181 ttgtggcggc tgcaggggcc tatgtccata tggtcactca tttcattcag gctggcctgc 241 tgtctgcctt gggctccctg atattgatga tttggctgat ggcaacacct catagccatg 301 aaactgaaca gaaaagactg ggacttcttg ctggatttgc attccttaca ggagttggcc 361 tgggccctgc cctggagttt tgtattgctg tcaaccccag catccttccc actgctttca 421 tgggcacggc aatgaTCTTT ACCTGCTTCA CCCTCAGTGC ACTCTATGCC AGGCGCCGTA 481 GCTACCTCTT TCTGGGAGGT ATCTTGATGT CAGCCCCGAG CTTGTTGCTT TTGTCTTCCC 541 TGGGGAATGT TTTCTTTGGA TCCATTTGGC TTTTCCAGGC AAACCTGTAT GTGGGACTGG 601 TGGTCATGTG TGGCTTCGTC CTTTTTGATA CTCAACTCAT TATTGAAAAG GCCGAACATG 661 GAGATCAAGA TTATATCTGG CACTGCATTG ATCTCTTCTT AGATTTCATT ACTGTCTTCA 721 GAAAACTCAT GATGATCCTG GCCATGAATG AAAAGGATAA GAAGAAAGAG AAGAAATGCC 781 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 841 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 901 ATATATCTTG TGGAAAGGAC GACATGCCGT TTCGGGTGAG CACCCCACGC GTTAAGTCga 961 caatcaacct ctggattaca aaatttgtga aagatt