Transcript: Human XM_024449173.1

PREDICTED: Homo sapiens transmembrane BAX inhibitor motif containing 6 (TMBIM6), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMBIM6 (7009)
Length:
2691
CDS:
134..847

Additional Resources:

NCBI RefSeq record:
XM_024449173.1
NBCI Gene record:
TMBIM6 (7009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144899 GATTATATCTGGCACTGCATT pLKO.1 737 CDS 100% 4.950 6.930 N TMBIM6 n/a
2 TRCN0000343374 GATTATATCTGGCACTGCATT pLKO_005 737 CDS 100% 4.950 6.930 N TMBIM6 n/a
3 TRCN0000141977 GCAGCAATCCTAATAGTCCTT pLKO.1 1884 3UTR 100% 2.640 3.696 N TMBIM6 n/a
4 TRCN0000343375 GCAGCAATCCTAATAGTCCTT pLKO_005 1884 3UTR 100% 2.640 3.696 N TMBIM6 n/a
5 TRCN0000144225 CCTGATATTGATGATTTGGCT pLKO.1 325 CDS 100% 0.750 1.050 N TMBIM6 n/a
6 TRCN0000142622 CGAGCCATTGAAAGCTCATTA pLKO.1 2241 3UTR 100% 13.200 10.560 N TMBIM6 n/a
7 TRCN0000144302 CGAACATGGAGATCAAGATTA pLKO.1 721 CDS 100% 13.200 9.240 N TMBIM6 n/a
8 TRCN0000343330 CGAACATGGAGATCAAGATTA pLKO_005 721 CDS 100% 13.200 9.240 N TMBIM6 n/a
9 TRCN0000141185 CAACACCTCATAGCCATGAAA pLKO.1 351 CDS 100% 5.625 3.938 N TMBIM6 n/a
10 TRCN0000352910 CAACACCTCATAGCCATGAAA pLKO_005 351 CDS 100% 5.625 3.938 N TMBIM6 n/a
11 TRCN0000142051 GCTCATTACCAGTAGGACATA pLKO.1 2254 3UTR 100% 4.950 3.465 N TMBIM6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07047 pDONR223 100% 99.8% 99.5% None 452T>C n/a
2 ccsbBroad304_07047 pLX_304 0% 99.8% 99.5% V5 452T>C n/a
3 TRCN0000477143 CATGCCGTTTCGGGTGAGCACCCC pLX_317 48.1% 99.8% 99.5% V5 452T>C n/a
Download CSV