Transcript: Mouse NM_026669.4

Mus musculus transmembrane BAX inhibitor motif containing 6 (Tmbim6), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmbim6 (110213)
Length:
2397
CDS:
123..836

Additional Resources:

NCBI RefSeq record:
NM_026669.4
NBCI Gene record:
Tmbim6 (110213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026669.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000349850 GAAGGCTGAACACGGAGATAA pLKO_005 704 CDS 100% 13.200 18.480 N Tmbim6 n/a
2 TRCN0000313010 GTGTCGTGTTCTATGATAATG pLKO_005 914 3UTR 100% 13.200 18.480 N Tmbim6 n/a
3 TRCN0000313011 TCGACACAGCAGCACCTAAAG pLKO_005 186 CDS 100% 10.800 15.120 N Tmbim6 n/a
4 TRCN0000119875 ACCTCTTCCTAGATTTCGTTA pLKO.1 748 CDS 100% 4.950 6.930 N Tmbim6 n/a
5 TRCN0000349410 ACCTCTTCCTAGATTTCGTTA pLKO_005 748 CDS 100% 4.950 6.930 N Tmbim6 n/a
6 TRCN0000119876 CCTAGATTTCGTTACCCTCTT pLKO.1 755 CDS 100% 4.050 5.670 N Tmbim6 n/a
7 TRCN0000119872 CAGGGCTAATTGTACTGAGTA pLKO.1 1583 3UTR 100% 4.950 3.960 N Tmbim6 n/a
8 TRCN0000119874 CCATGTGGTCACACACTTCAT pLKO.1 263 CDS 100% 4.950 3.960 N Tmbim6 n/a
9 TRCN0000311939 CCATGTGGTCACACACTTCAT pLKO_005 263 CDS 100% 4.950 3.960 N Tmbim6 n/a
10 TRCN0000119873 CCTCTTTGATACTCAGCTCAT pLKO.1 677 CDS 100% 4.050 2.835 N Tmbim6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026669.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07047 pDONR223 100% 86% 93.6% None (many diffs) n/a
2 ccsbBroad304_07047 pLX_304 0% 86% 93.6% V5 (many diffs) n/a
3 TRCN0000477143 CATGCCGTTTCGGGTGAGCACCCC pLX_317 48.1% 86% 93.6% V5 (many diffs) n/a
Download CSV