Construct: ORF TRCN0000477218
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014933.1_s317c1
- Derived from:
- ccsbBroadEn_00192
- DNA Barcode:
- AGGGTCACATAGTCAATGAGGGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MPPED2 (744)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477218
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 744 | MPPED2 | metallophosphoesterase doma... | NM_001584.2 | 100% | 100% | |
| 2 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_005253110.4 | 100% | 100% | |
| 3 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_005253111.2 | 100% | 100% | |
| 4 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_005253112.1 | 100% | 100% | |
| 5 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_024448675.1 | 100% | 100% | |
| 6 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_024448676.1 | 100% | 100% | |
| 7 | human | 744 | MPPED2 | metallophosphoesterase doma... | NM_001145399.2 | 90.9% | 87% | (many diffs) |
| 8 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018232.2 | 90.9% | 87% | (many diffs) |
| 9 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018231.1 | 90.6% | 82% | (many diffs) |
| 10 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018233.2 | 74.8% | 74.8% | 0_1ins222 |
| 11 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018234.2 | 74.8% | 74.8% | 0_1ins222 |
| 12 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_005253114.4 | 61.3% | 60.5% | (many diffs) |
| 13 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_011520346.1 | 57.1% | 57.1% | 0_1ins378 |
| 14 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_011520347.3 | 57.1% | 57.1% | 0_1ins378 |
| 15 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018235.2 | 57.1% | 57.1% | 0_1ins378 |
| 16 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018236.2 | 57.1% | 57.1% | 0_1ins378 |
| 17 | human | 744 | MPPED2 | metallophosphoesterase doma... | XM_017018237.1 | 57.1% | 57.1% | 0_1ins378 |
| 18 | mouse | 77015 | Mpped2 | metallophosphoesterase doma... | NM_001143683.1 | 95.8% | 99.6% | (many diffs) |
| 19 | mouse | 77015 | Mpped2 | metallophosphoesterase doma... | NM_029837.1 | 95.8% | 99.6% | (many diffs) |
| 20 | mouse | 77015 | Mpped2 | metallophosphoesterase doma... | XM_011239841.1 | 95.8% | 99.6% | (many diffs) |
| 21 | mouse | 77015 | Mpped2 | metallophosphoesterase doma... | XM_006500393.1 | 53.4% | 56.8% | (many diffs) |
| 22 | mouse | 77015 | Mpped2 | metallophosphoesterase doma... | XM_006500394.3 | 53.4% | 56.8% | (many diffs) |
| 23 | mouse | 77015 | Mpped2 | metallophosphoesterase doma... | XM_011239842.2 | 53.4% | 56.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc acatgggatt ccttctcaag gcaaagttac cataacggtg gatgagtaca 121 gctcaaaccc cacccaggca ttcacgcact acaacatcaa ccagagcaga ttccagcctc 181 cacatgtaca tatggtcgac cccatcccat atgacactcc aaaaccagcg ggccacacgc 241 ggtttgtctg catctcagac acacactcca gaacagatgg tatccagatg ccttatgggg 301 acatccttct ccacacaggc gatttcaccg agctgggact gccctcagag gttaagaagt 361 ttaatgactg gttaggaaac ctgccatatg aatataaaat agtgattgct gggaatcatg 421 aactgacatt tgataaggaa ttcatggcag accttgttaa acaggactac taccgtttcc 481 cctctgtgtc caaattgaaa ccagaggact ttgacaatgt tcagtccctc ctgacaaaca 541 gtatttactt acaagatTCG GAGGTAACAG TGAAGGGATT CAGGATATAC GGTGCACCTT 601 GGACCCCGTG GTTTAATGGA TGGGGCTTTA ACCTACCCAG AGGTCAGTCT CTGCTGGACA 661 AGTGGAACCT CATCCCTGAG GGCATTGACA TACTCATGAC ACATGGACCT CCTCTAGGTT 721 TTCGAGACTG GGTTCCAAAG GAGCTTCAAA GAGTGGGCTG TGTGGAGCTG TTAAACACGG 781 TTCAGAGGCG AGTCCGGCCC AAGCTCCATG TGTTTGGTGG AATCCATGAA GGTTATGGCA 841 TCATGACCGA CGGTTACACA ACGTACATCA ATGCCTCGAC GTGTACAGTC AGCTTTCAAC 901 CGACCAACCC TCCAATTATA TTTGACCTTC CAAACCCACA GGGTTCCTGC CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGAAGGGTCA CATAGTCAAT GAGGGCAACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt