Transcript: Human XM_017018234.2

PREDICTED: Homo sapiens metallophosphoesterase domain containing 2 (MPPED2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPPED2 (744)
Length:
2730
CDS:
821..1483

Additional Resources:

NCBI RefSeq record:
XM_017018234.2
NBCI Gene record:
MPPED2 (744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050752 CCATGAAGGTTATGGCATCAT pLKO.1 1357 CDS 100% 4.950 6.930 N MPPED2 n/a
2 TRCN0000050748 CGACGGTTACACAACGTACAT pLKO.1 1381 CDS 100% 4.950 6.930 N MPPED2 n/a
3 TRCN0000050749 CCTCCTGACAAACAGTATTTA pLKO.1 1060 CDS 100% 15.000 10.500 N MPPED2 n/a
4 TRCN0000050750 CCTCAGAGGTTAAGAAGTTTA pLKO.1 876 CDS 100% 13.200 9.240 N MPPED2 n/a
5 TRCN0000050751 CCTTGTTAAACAGGACTACTA pLKO.1 985 CDS 100% 4.950 3.465 N MPPED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018234.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00192 pDONR223 100% 74.8% 74.8% None 0_1ins222 n/a
2 ccsbBroad304_00192 pLX_304 0% 74.8% 74.8% V5 0_1ins222 n/a
3 TRCN0000477218 AGGGTCACATAGTCAATGAGGGCA pLX_317 44.4% 74.8% 74.8% V5 0_1ins222 n/a
Download CSV