Construct: ORF TRCN0000477242
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003969.1_s317c1
- Derived from:
- ccsbBroadEn_05879
- DNA Barcode:
- CCACTGGCAGTGCGTATACGAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BCKDHA (593)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477242
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 593 | BCKDHA | branched chain keto acid de... | NM_000709.4 | 99.7% | 99.7% | 7G>C;972C>T;1221A>G |
2 | human | 593 | BCKDHA | branched chain keto acid de... | NM_001164783.2 | 99.5% | 99.5% | (many diffs) |
3 | mouse | 12039 | Bckdha | branched chain ketoacid deh... | NM_007533.5 | 86.9% | 92.3% | (many diffs) |
4 | mouse | 12039 | Bckdha | branched chain ketoacid deh... | XM_006539486.3 | 83.8% | 88.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1401
- ORF length:
- 1335
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gctagcgatc gctgcagcga gggtctggcg gctaaaccgt ggtttgagcc 121 aggctgccct cctgctgctg cggcagcctg gggctcgggg actggctaga tctcaccccc 181 ccaggcagca gcagcagttt tcatctctgg atgacaagcc ccagttccca ggggcctcgg 241 cggagtttat agataagttg gaattcatcc agcccaacgt catctctgga atccccatct 301 accgcgtcat ggaccggcaa ggccagatca tcaaccccag cgaggacccc cacctgccga 361 aggagaaggt gctgaagctc tacaagagca tgacactgct taacaccatg gaccgcatcc 421 tctatgagtc tcagcggcag ggccggatct ccttctacat gaccaactat ggtgaggagg 481 gcacgcacgt ggggagtgcc gccgccctgg acaacacgga cctggtgttt ggccagtacc 541 gggaggcagg tgtgctgatg tatcgggact accccctgga actattcatg gcccagtgct 601 atggcaacat cagtgacttg ggcaaggggc gccagatgcc tgtccactac ggctgcaagg 661 aacgccactt cgtcactatc tcctctccac tggccacgca gatccctcag gcggtggggg 721 cggcgtacgc agccaagcgg gccaatgcca acagggtcgt catctgttac ttcggcgagg 781 gggcagccag tgagggggac gcccatgccg gcttcaactt cgctgccaca cttgagtgcc 841 ccatcatctt cttctgccgg aacaatggct acgccatctc cacgcccacc tctgagcagt 901 atcgcggcga tggcattgca gcacgaggcc ccgggtatgg catcatgtca atccgcgtgg 961 atggtaatga tgtgtttgcc gtatacaacg ccacaaagga ggcccgacgg cgggctgtgg 1021 cagagaacca gccctttctc atcgaggcca tgacctacag gatcgggcac cacagcacca 1081 gtgacgacag ttcagcgtac cgctcggtgg atgaggtcaa ttactgggat aaacaggacc 1141 accccatctc ccggctgcgg cactatctgc TGAGCCAAGG CTGGTGGGAT GAGGAGCAGG 1201 AGAAGGCCTG GAGGAAGCAG TCCCGCAGGA AGGTGATGGA GGCCTTTGAG CAGGCCGAGC 1261 GGAAGCCCAA ACCCAACCCC AACCTGCTCT TCTCAGACGT GTATCAGGAG ATGCCCGCCC 1321 AGCTCCGCAA GCAGCAGGAG TCTCTGGCCC GCCACCTGCA GACCTACGGG GAGCACTACC 1381 CACTGGATCA CTTCGATAAG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1441 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1501 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCAC TGGCAGTGCG 1561 TATACGAAAT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt