Transcript: Mouse NM_007533.5

Mus musculus branched chain ketoacid dehydrogenase E1, alpha polypeptide (Bckdha), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Bckdha (12039)
Length:
1773
CDS:
22..1362

Additional Resources:

NCBI RefSeq record:
NM_007533.5
NBCI Gene record:
Bckdha (12039)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007533.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041384 GCAGTCACGAAAGAAGGTCAT pLKO.1 1176 CDS 100% 4.050 5.670 N Bckdha n/a
2 TRCN0000315504 GCAGTCACGAAAGAAGGTCAT pLKO_005 1176 CDS 100% 4.050 5.670 N Bckdha n/a
3 TRCN0000041385 CGAGGTCAATTACTGGGACAA pLKO.1 1071 CDS 100% 4.050 3.240 N Bckdha n/a
4 TRCN0000308660 CGAGGTCAATTACTGGGACAA pLKO_005 1071 CDS 100% 4.050 3.240 N Bckdha n/a
5 TRCN0000041383 CCGGATTGTGATCTGTTACTT pLKO.1 711 CDS 100% 5.625 3.938 N Bckdha n/a
6 TRCN0000308727 CCGGATTGTGATCTGTTACTT pLKO_005 711 CDS 100% 5.625 3.938 N Bckdha n/a
7 TRCN0000041387 TCCTTCTACATGACCAACTAT pLKO.1 409 CDS 100% 5.625 3.938 N Bckdha n/a
8 TRCN0000308659 TCCTTCTACATGACCAACTAT pLKO_005 409 CDS 100% 5.625 3.938 N Bckdha n/a
9 TRCN0000041386 GCTTGAGTTCATCCAGCCCAA pLKO.1 216 CDS 100% 2.160 1.512 N Bckdha n/a
10 TRCN0000308728 GCTTGAGTTCATCCAGCCCAA pLKO_005 216 CDS 100% 2.160 1.512 N Bckdha n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007533.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05879 pDONR223 100% 86.9% 92.3% None (many diffs) n/a
2 ccsbBroad304_05879 pLX_304 0% 86.9% 92.3% V5 (many diffs) n/a
3 TRCN0000477242 CCACTGGCAGTGCGTATACGAAAT pLX_317 17.7% 86.9% 92.3% V5 (many diffs) n/a
Download CSV