Transcript: Human NM_000709.4

Homo sapiens branched chain keto acid dehydrogenase E1 subunit alpha (BCKDHA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BCKDHA (593)
Length:
1742
CDS:
11..1348

Additional Resources:

NCBI RefSeq record:
NM_000709.4
NBCI Gene record:
BCKDHA (593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028432 GAGGTCAATTACTGGGATAAA pLKO.1 1058 CDS 100% 13.200 18.480 N BCKDHA n/a
2 TRCN0000028404 CCCACTGGATCACTTCGATAA pLKO.1 1324 CDS 100% 10.800 15.120 N BCKDHA n/a
3 TRCN0000343781 CCCACTGGATCACTTCGATAA pLKO_005 1324 CDS 100% 10.800 15.120 N BCKDHA n/a
4 TRCN0000041387 TCCTTCTACATGACCAACTAT pLKO.1 395 CDS 100% 5.625 3.938 N Bckdha n/a
5 TRCN0000308659 TCCTTCTACATGACCAACTAT pLKO_005 395 CDS 100% 5.625 3.938 N Bckdha n/a
6 TRCN0000028473 GTGGATGGTAATGATGTGTTT pLKO.1 902 CDS 100% 4.950 3.465 N BCKDHA n/a
7 TRCN0000343710 GTGGATGGTAATGATGTGTTT pLKO_005 902 CDS 100% 4.950 3.465 N BCKDHA n/a
8 TRCN0000028398 CCTACTCTTCTCAGACGTGTA pLKO.1 1228 CDS 100% 4.050 2.835 N BCKDHA n/a
9 TRCN0000343711 CCTACTCTTCTCAGACGTGTA pLKO_005 1228 CDS 100% 4.050 2.835 N BCKDHA n/a
10 TRCN0000028456 GCTGAAGCTCTACAAGAGCAT pLKO.1 316 CDS 100% 2.640 1.848 N BCKDHA n/a
11 TRCN0000343709 GCTGAAGCTCTACAAGAGCAT pLKO_005 316 CDS 100% 2.640 1.848 N BCKDHA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000709.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05879 pDONR223 100% 99.7% 99.7% None 7G>C;972C>T;1221A>G n/a
2 ccsbBroad304_05879 pLX_304 0% 99.7% 99.7% V5 7G>C;972C>T;1221A>G n/a
3 TRCN0000477242 CCACTGGCAGTGCGTATACGAAAT pLX_317 17.7% 99.7% 99.7% V5 7G>C;972C>T;1221A>G n/a
Download CSV