Construct: ORF TRCN0000477314
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010268.1_s317c1
- Derived from:
- ccsbBroadEn_06261
- DNA Barcode:
- CGCTTGGGATTCACACGGGACGGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GATA4 (2626)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477314
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2626 | GATA4 | GATA binding protein 4 | NM_002052.5 | 99.8% | 99.7% | 448G>T;699G>T |
| 2 | human | 2626 | GATA4 | GATA binding protein 4 | NM_001308093.2 | 99.6% | 99.5% | 448G>T;616_618delGTA;702G>T |
| 3 | human | 2626 | GATA4 | GATA binding protein 4 | XM_005272385.4 | 99.6% | 99.5% | 448G>T;616_618delGTA;702G>T |
| 4 | human | 2626 | GATA4 | GATA binding protein 4 | XM_011543817.3 | 99.6% | 99.5% | 448G>T;616_618delGTA;702G>T |
| 5 | human | 2626 | GATA4 | GATA binding protein 4 | XM_011543818.2 | 99.6% | 99.5% | 448G>T;616_618delGTA;702G>T |
| 6 | human | 2626 | GATA4 | GATA binding protein 4 | XM_017013312.2 | 99.6% | 99.5% | 448G>T;616_618delGTA;702G>T |
| 7 | human | 2626 | GATA4 | GATA binding protein 4 | NM_001308094.2 | 53.3% | 53.3% | 0_1ins618;81G>T |
| 8 | human | 2626 | GATA4 | GATA binding protein 4 | NM_001374273.1 | 53.3% | 53.3% | 0_1ins618;81G>T |
| 9 | human | 2626 | GATA4 | GATA binding protein 4 | NM_001374274.1 | 43.8% | 43.8% | 0_1ins618;81G>T;164_165ins126 |
| 10 | mouse | 14463 | Gata4 | GATA binding protein 4 | NM_008092.4 | 87.1% | 92.3% | (many diffs) |
| 11 | mouse | 14463 | Gata4 | GATA binding protein 4 | NM_001310610.1 | 86.9% | 92.1% | (many diffs) |
| 12 | mouse | 14463 | Gata4 | GATA binding protein 4 | XM_011244956.2 | 86.9% | 92.1% | (many diffs) |
| 13 | mouse | 14463 | Gata4 | GATA binding protein 4 | XM_011244957.2 | 86.9% | 92.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1395
- ORF length:
- 1326
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtatcagagc ttggccatgg ccgccaacca cgggccgccc cccggtgcct 121 acgaggcggg cggccccggc gccttcatgc acggcgcggg cgccgcgtcc tcgccagtct 181 acgtgcccac accgcgggtg ccctcctccg tgctgggcct gtcctacctc cagggcggag 241 gcgcgggctc tgcgtccgga ggcgcctcgg gcggcagctc cggtggggcc gcgtctggtg 301 cggggcccgg gacccagcag ggcagcccgg gatggagcca ggcgggagcc gacggagccg 361 cttacacccc gccgccggtg tcgccgcgct tctccttccc ggggaccacc gggtccctgg 421 cggccgccgc cgccgctgcc gcggcccggg aagctgcggc ctacagcagt ggcggcggag 481 cggcgggtgc gggcctggcg ggccgcgagc agtactggcg cgccggcttc gcgggctcct 541 actccagccc ctacccggct tacatggccg acgtgggcgc gtcctgggcc gcagccgccg 601 ccgcctccgc cggccccttc gacagcccgg tcctgcacag cctgcccggc cgggccaacc 661 cggccgcccg acaccccaat ctcgatatgt ttgacgactt ctcagaaggc agagagtgtg 721 tcaactgtgg ggctatgtcc accccgctct ggaggcgaga tgggactggt cactatctgt 781 gcaacgcctg cggcctctac cacaagatga acggcatcaa ccggccgctc atcaagcctc 841 agcgccggct gtccgcctcc cgccgagtgg gcctctcctg tgccaactgc cagaccacca 901 ccaccacgct gtggcgccgc aatgcggagg gcgagcctgt gtgcaatgcc tgcggcctct 961 acatgaagct ccacggggtc cccaggcctc ttgcaatgcg gaaagagggg atccaaacca 1021 gaaaacggaa gcccaagaac ctgaataaat ctaagacacc agcagctcct tcaggcagtg 1081 agagccTTCC TCCCGCCAGC GGTGCTTCCA GCAACTCCAG CAACGCCACC ACCAGCAGCA 1141 GCGAGGAGAT GCGTCCCATC AAGACGGAGC CTGGCCTGTC ATCTCACTAC GGGCACAGCA 1201 GCTCCGTGTC CCAGACGTTC TCAGTCAGTG CGATGTCTGG CCATGGGCCC TCCATCCACC 1261 CTGTCCTCTC GGCCCTGAAG CTCTCCCCAC AAGGCTATGC GTCTCCCGTC AGCCAGTCTC 1321 CACAGACCAG CTCCAAGCAG GACTCTTGGA ACAGCCTGGT CTTGGCCGAC AGTCACGGGG 1381 ACATAATCAC TGCGTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1441 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1501 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CGCTTGGGAT TCACACGGGA 1561 CGGAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt