Transcript: Human NM_001308093.2

Homo sapiens GATA binding protein 4 (GATA4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GATA4 (2626)
Length:
3316
CDS:
458..1789

Additional Resources:

NCBI RefSeq record:
NM_001308093.2
NBCI Gene record:
GATA4 (2626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329713 GGACATAATCACTGCGTAATC pLKO_005 1771 CDS 100% 10.800 15.120 N GATA4 n/a
2 TRCN0000020426 CGAGGAGATGCGTCCCATCAA pLKO.1 1534 CDS 100% 1.650 1.320 N GATA4 n/a
3 TRCN0000329769 CGAGGAGATGCGTCCCATCAA pLKO_005 1534 CDS 100% 1.650 1.320 N GATA4 n/a
4 TRCN0000095216 AGCCCAAGAACCTGAATAAAT pLKO.1 1422 CDS 100% 15.000 10.500 N Gata4 n/a
5 TRCN0000329714 GGAAGCCCAAGAACCTGAATA pLKO_005 1419 CDS 100% 13.200 9.240 N GATA4 n/a
6 TRCN0000020424 CCAGAGATTCTGCAACACGAA pLKO.1 2864 3UTR 100% 2.640 1.848 N GATA4 n/a
7 TRCN0000329770 CCAGAGATTCTGCAACACGAA pLKO_005 2864 3UTR 100% 2.640 1.848 N GATA4 n/a
8 TRCN0000020427 CTGAATAAATCTAAGACACCA pLKO.1 1433 CDS 100% 2.640 1.848 N GATA4 n/a
9 TRCN0000020428 CCCGGCTTACATGGCCGACGT pLKO.1 943 CDS 100% 0.000 0.000 N GATA4 n/a
10 TRCN0000095218 GAAGGCAGAGAGTGTGTCAAT pLKO.1 1097 CDS 100% 4.950 3.465 N Gata4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308093.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06261 pDONR223 100% 99.6% 99.5% None 448G>T;616_618delGTA;702G>T n/a
2 ccsbBroad304_06261 pLX_304 0% 99.6% 99.5% V5 448G>T;616_618delGTA;702G>T n/a
3 TRCN0000477314 CGCTTGGGATTCACACGGGACGGA pLX_317 23.6% 99.6% 99.5% V5 448G>T;616_618delGTA;702G>T n/a
Download CSV