Transcript: Mouse XM_011244957.2

PREDICTED: Mus musculus GATA binding protein 4 (Gata4), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gata4 (14463)
Length:
3449
CDS:
667..1995

Additional Resources:

NCBI RefSeq record:
XM_011244957.2
NBCI Gene record:
Gata4 (14463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095216 AGCCCAAGAACCTGAATAAAT pLKO.1 1628 CDS 100% 15.000 10.500 N Gata4 n/a
2 TRCN0000095214 CGAACCAAGATTCTGTTGTAA pLKO.1 3296 3UTR 100% 5.625 3.938 N Gata4 n/a
3 TRCN0000095217 CATCTCCTGTCACTCAGACAT pLKO.1 1898 CDS 100% 4.950 3.465 N Gata4 n/a
4 TRCN0000329714 GGAAGCCCAAGAACCTGAATA pLKO_005 1625 CDS 100% 13.200 7.920 N GATA4 n/a
5 TRCN0000095218 GAAGGCAGAGAGTGTGTCAAT pLKO.1 1303 CDS 100% 4.950 2.970 N Gata4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244957.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06261 pDONR223 100% 86.9% 92.1% None (many diffs) n/a
2 ccsbBroad304_06261 pLX_304 0% 86.9% 92.1% V5 (many diffs) n/a
3 TRCN0000477314 CGCTTGGGATTCACACGGGACGGA pLX_317 23.6% 86.9% 92.1% V5 (many diffs) n/a
Download CSV