Construct: ORF TRCN0000477374
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000425.1_s317c1
- Derived from:
- ccsbBroadEn_00008
- DNA Barcode:
- CTACAATTTCTGTTCTGCACCTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ASIC1 (41)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477374
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 41 | ASIC1 | acid sensing ion channel su... | NM_001095.4 | 99.9% | 100% | 159C>G |
| 2 | human | 41 | ASIC1 | acid sensing ion channel su... | XM_011538352.1 | 99.7% | 99.8% | 159C>G;837_839delGCA |
| 3 | human | 41 | ASIC1 | acid sensing ion channel su... | XM_011538351.2 | 94.3% | 94.4% | 159C>G;558_650del |
| 4 | human | 41 | ASIC1 | acid sensing ion channel su... | XM_011538350.1 | 94.2% | 94.2% | 159C>G;558_650del;930_932delGCA |
| 5 | human | 41 | ASIC1 | acid sensing ion channel su... | NM_020039.4 | 91.9% | 91.9% | 159C>G;1297_1434del |
| 6 | human | 41 | ASIC1 | acid sensing ion channel su... | NM_001256830.1 | 75.5% | 72.4% | (many diffs) |
| 7 | human | 41 | ASIC1 | acid sensing ion channel su... | NR_046389.2 | 39.8% | (many diffs) | |
| 8 | mouse | 11419 | Asic1 | acid-sensing (proton-gated)... | NM_009597.1 | 91.4% | 97.9% | (many diffs) |
| 9 | mouse | 11419 | Asic1 | acid-sensing (proton-gated)... | XM_006520297.3 | 91.2% | 97.7% | (many diffs) |
| 10 | mouse | 11419 | Asic1 | acid-sensing (proton-gated)... | XM_006520298.3 | 91.2% | 97.7% | (many diffs) |
| 11 | mouse | 11419 | Asic1 | acid-sensing (proton-gated)... | XM_017316366.1 | 40.1% | 43.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1653
- ORF length:
- 1584
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaactgaag gccgaggagg aggaggtggg tggcgtccag ccggtgagca 121 tccaggcctt cgccagcagc tccacactgc acggcctggc ccacatcttc tcctacgagc 181 ggctgtctct gaagcgggca ctgtgggccc tgtgcttcct gggctcgctg gctgtgctgc 241 tgtgtgtgtg cacggagcgt gtgcagtact acttccacta ccaccatgtc accaagctcg 301 acgaggtggc tgcctctcag cttaccttcc ctgctgtcac gctgtgcaac ctcaacgagt 361 tccgctttag ccaagtctcc aagaatgacc tgtatcatgc tggggagctg ctggccctgc 421 tcaacaacag gtatgagata ccagacacac agatggcaga tgaaaagcag ctggagatac 481 tgcaggacaa agccaacttc cgcagcttca aacccaaacc cttcaacatg cgtgagttct 541 acgaccgagc tgggcacgac attcgagaca tgctgctctc ctgccacttc cggggggagg 601 tctgcagcgc tgaagacttc aaggtggtct tcacacgcta tggaaagtgc tacacgttca 661 actcgggccg agatgggcgg ccgcggctga agaccatgaa gggtgggacg ggcaatgggc 721 tggaaatcat gctggacatc cagcaggacg agtacctgcc tgtgtggggg gagactgacg 781 agacgtcctt cgaagcaggc atcaaagtgc agatccatag tcaggatgaa cctcctttca 841 tcgaccagct gggctttggc gtggccccag gcttccagac ctttgtggcc tgccaggagc 901 agcggctcat ctacctgccc ccaccctggg gcacctgcaa agctgttacc atggactcgg 961 atttggattt cttcgactcc tacagcatca ctgcctgccg catcgactgt gagacgcgct 1021 acctggtgga gaactgcaac tgccgcatgg tgcacatgcc aggggatgcc ccatactgta 1081 ctccagagca gtacaaggag tgtgcagatc ctgctctgga cttcctggtg gagaaggacc 1141 aggagtactg cgtgtgtgaa atgccttgca acctgacccg ctatggcaaa gagctgtcca 1201 tggtcaagat ccccagcaaa gccTCAGCCA AGTACCTGGC CAAGAAGTTC AACAAATCTG 1261 AGCAATACAT AGGGGAGAAC ATCCTGGTGC TGGACATTTT CTTTGAAGTC CTCAACTATG 1321 AGACCATTGA ACAGAAGAAG GCCTATGAGA TTGCAGGGCT CCTGGGTGAC ATCGGGGGCC 1381 AGATGGGGCT GTTCATCGGG GCCAGCATCC TCACGGTGCT GGAGCTCTTT GACTACGCCT 1441 ACGAGGTCAT TAAGCACAAG CTGTGCCGAC GAGGAAAATG CCAGAAGGAG GCCAAAAGGA 1501 GCAGTGCGGA CAAGGGCGTG GCCCTCAGCC TGGACGACGT CAAAAGACAC AACCCGTGCG 1561 AGAGCCTTCG GGGCCACCCT GCCGGGATGA CATACGCTGC CAACATCCTA CCTCACCATC 1621 CGGCCCGAGG CACGTTCGAG GACTTTACCT GCTTGCCAAC TTTCTTGTAC AAAGTGGTTG 1681 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1741 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACT 1801 ACAATTTCTG TTCTGCACCT TAACGCGTTA AGTCgacaat caacctctgg attacaaaat 1861 ttgtgaaaga tt