Transcript: Human XM_011538351.2

PREDICTED: Homo sapiens acid sensing ion channel subunit 1 (ASIC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASIC1 (41)
Length:
3732
CDS:
80..1759

Additional Resources:

NCBI RefSeq record:
XM_011538351.2
NBCI Gene record:
ASIC1 (41)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161803 CGGATTTGGATTTCTTCGACT pLKO.1 1062 CDS 100% 2.640 3.696 N ASIC1 n/a
2 TRCN0000163547 GCTGTAGGCTACATCCTGATA pLKO.1 2384 3UTR 100% 4.950 3.960 N ASIC1 n/a
3 TRCN0000319159 GCTGTAGGCTACATCCTGATA pLKO_005 2384 3UTR 100% 4.950 3.960 N ASIC1 n/a
4 TRCN0000161770 CTATGGAAAGTGCTACACGTT pLKO.1 742 CDS 100% 2.640 2.112 N ASIC1 n/a
5 TRCN0000319158 CTATGGAAAGTGCTACACGTT pLKO_005 742 CDS 100% 2.640 2.112 N ASIC1 n/a
6 TRCN0000161735 CAAACCCAAACCCTTCAACAT pLKO.1 520 CDS 100% 4.950 3.465 N ASIC1 n/a
7 TRCN0000162879 GCGACAAAGGAAGCTGTGAAT pLKO.1 2926 3UTR 100% 4.950 3.465 N ASIC1 n/a
8 TRCN0000349603 GCGACAAAGGAAGCTGTGAAT pLKO_005 2926 3UTR 100% 4.950 3.465 N ASIC1 n/a
9 TRCN0000161677 GCTCAACAACAGGTATGAGAT pLKO.1 430 CDS 100% 4.950 3.465 N ASIC1 n/a
10 TRCN0000319230 GCTCAACAACAGGTATGAGAT pLKO_005 430 CDS 100% 4.950 3.465 N ASIC1 n/a
11 TRCN0000164080 CGAGGTCATTAAGCACAAGCT pLKO.1 1546 CDS 100% 2.640 1.848 N ASIC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538351.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00008 pDONR223 100% 94.3% 94.4% None 159C>G;558_650del n/a
2 ccsbBroad304_00008 pLX_304 0% 94.3% 94.4% V5 159C>G;558_650del n/a
3 TRCN0000477374 CTACAATTTCTGTTCTGCACCTTA pLX_317 27.3% 94.3% 94.4% V5 159C>G;558_650del n/a
Download CSV