Transcript: Mouse XM_017316366.1

PREDICTED: Mus musculus acid-sensing (proton-gated) ion channel 1 (Asic1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Asic1 (11419)
Length:
4282
CDS:
1592..2290

Additional Resources:

NCBI RefSeq record:
XM_017316366.1
NBCI Gene record:
Asic1 (11419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173157 CCTGCCGGATTGATTGTGAAA pLKO.1 1629 CDS 100% 4.950 6.930 N Asic1 n/a
2 TRCN0000194120 GACTATGCCTATGAGGTCATT pLKO.1 2066 CDS 100% 4.950 6.930 N Asic1 n/a
3 TRCN0000161677 GCTCAACAACAGGTATGAGAT pLKO.1 432 5UTR 100% 4.950 3.960 N ASIC1 n/a
4 TRCN0000319230 GCTCAACAACAGGTATGAGAT pLKO_005 432 5UTR 100% 4.950 3.960 N ASIC1 n/a
5 TRCN0000194156 GTTTGAGGACTTTACCTGCTA pLKO.1 2269 CDS 100% 2.640 2.112 N Asic1 n/a
6 TRCN0000175504 CCTCAAGCATACGGAATCTTT pLKO.1 2847 3UTR 100% 5.625 3.938 N Asic1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00008 pDONR223 100% 40.1% 43.5% None (many diffs) n/a
2 ccsbBroad304_00008 pLX_304 0% 40.1% 43.5% V5 (many diffs) n/a
3 TRCN0000477374 CTACAATTTCTGTTCTGCACCTTA pLX_317 27.3% 40.1% 43.5% V5 (many diffs) n/a
Download CSV