Construct: ORF TRCN0000477458
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015358.1_s317c1
- Derived from:
- ccsbBroadEn_09340
- DNA Barcode:
- TTGTCATACCGCACTTCGCCCATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PXYLP1 (92370)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477458
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 92370 | PXYLP1 | 2-phosphoxylose phosphatase 1 | NM_001037172.3 | 99.8% | 100% | 216C>T;1026C>T |
| 2 | human | 92370 | PXYLP1 | 2-phosphoxylose phosphatase 1 | NM_152282.4 | 99.8% | 100% | 216C>T;1026C>T |
| 3 | human | 92370 | PXYLP1 | 2-phosphoxylose phosphatase 1 | XM_024453830.1 | 96% | 91.9% | (many diffs) |
| 4 | human | 92370 | PXYLP1 | 2-phosphoxylose phosphatase 1 | XM_005247903.4 | 95.1% | 95.2% | (many diffs) |
| 5 | human | 92370 | PXYLP1 | 2-phosphoxylose phosphatase 1 | NM_001282728.1 | 91.9% | 92% | 0_1ins114;102C>T;912C>T |
| 6 | human | 92370 | PXYLP1 | 2-phosphoxylose phosphatase 1 | XM_017007511.1 | 91.9% | 92% | 0_1ins114;102C>T;912C>T |
| 7 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | NM_001289645.1 | 84.5% | 89.1% | (many diffs) |
| 8 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | NM_001289646.1 | 84.5% | 89.1% | (many diffs) |
| 9 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | NM_001289647.1 | 84.5% | 89.1% | (many diffs) |
| 10 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | NM_153420.3 | 84.5% | 89.1% | (many diffs) |
| 11 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | XM_006511138.3 | 84.5% | 89.1% | (many diffs) |
| 12 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | XM_017313346.1 | 84.5% | 89.1% | (many diffs) |
| 13 | mouse | 235534 | Pxylp1 | 2-phosphoxylose phosphatase 1 | XM_006511139.2 | 81.2% | 85.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1506
- ORF length:
- 1440
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct tttccgcaac cgcttcttgc tgctgctggc cctggctgcg ctgctggcct 121 ttgtgagcct cagcctgcag ttcttccacc tgatcccggt gtcgactcct aagaatggaa 181 tgagtagcaa gagtcgaaag agaatcatgc ccgaccctgt gacggagccc cctgtgacag 241 accccgttta tgaagctctt ttgtactgca acatccccag tgtggccgag cgcagcatgg 301 aaggtcatgc cccgcatcat tttaagctgg tctcagtgca tgtgttcatt cgccacggag 361 acaggtaccc actgtatgtc attcccaaaa caaagcgacc agaaattgac tgcactctgg 421 tggctaacag gaaaccgtat cacccaaaac tggaagcttt cattagtcac atgtcaaaag 481 gatccggagc ctctttcgaa agccccttga actccttgcc tctttaccca aatcacccat 541 tgtgtgagat gggagagctc acacagacag gagttgtgca gcatttgcag aacggtcagc 601 tgctgaggga tatctatcta aagaaacaca aactcctgcc caatgattgg tctgcagacc 661 agctctattt agagaccact gggaaaagcc ggaccctaca aagtgggctg gccttgcttt 721 atggctttct cccagatttt gactggaaga agatttattt caggcaccag ccaagtgcgc 781 tgttctgctc tggaagctgc tattgcccgg taagaaacca gtatctggaa aaggagcagc 841 gtcgtcagta cctcctacgt ttgaaaaaca gccagctgga gaagacctac ggggagatgg 901 ccaagatcgt ggatgtcccc accaagcagc ttagagctgc caaccccata gactccatgc 961 tctgccactt ctgccacaat gtcagctttc cctgtaccag aaatggctgt gttgacatgg 1021 agcacttcaa ggtaattaag acccatcaga tcgaggatga aagggaaaga cgggagaaga 1081 aattgtactt tgggtattct ctcctgggtg cccaccccat cctgaaccaa accatcggcc 1141 ggatgcagcg tgccaccGAG GGCAGGAAAG AAGAGCTCTT TGCCCTCTAC TCTGCTCATG 1201 ATGTCACTCT GTCACCAGTT CTCAGTGCCT TGGGCCTTTC AGAAGCCAGG TTCCCAAGGT 1261 TTGCAGCCAG GTTGATCTTT GAGCTTTGGC AAGACAGAGA AAAGCCCAGT GAACATTCCG 1321 TCCGGATTCT TTACAATGGC GTCGATGTCA CATTCCACAC CTCTTTCTGC CAAGACCACC 1381 ACAAGCGTTC TCCCAAGCCC ATGTGCCCGC TTGAAAACTT GGTCCGCTTT GTGAAAAGGG 1441 ACATGTTTGT AGCCCTGGGT GGCAGTGGTA CAAATTATTA TGATGCATGT CACAGGGAAG 1501 GATTCTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1561 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1621 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATTGTCATAC CGCACTTCGC CCATCACGCG 1681 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt